SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14489
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.175 Nuclear   Reliability : 1.508
 

Sequence

CDS
ATGGCTGGTTTCCGAGCGCTATCTCATCAACCTACGAGCTCTGATGGTGAAGTTAAAAAAAAAATTAGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGGCAAACATTGCCACGACGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGAGTCCCCACCGTGCGCCTCGAACGCTGCGAGAGCCTGATCTCGCTCTACTCGGCGCGGAGCTCCGCAAGGGGCGACGCGTCCAGTGGGCGGGAGACGCCAGCGCTGTTCGTGGACAGTGCTCGACAGCGCACTAGACGGAAGAGGAAGTCGGCTCGTCAGCCGGCATCTGTCCCTCCGTCCGACTCCTCGGAAGGAGAGCCTACCAGCGCCAAGTACTTGGCGTTGGCGGAAGGGCCGGCGACTGCTGCGGCGTCGCCCGCCACCGGCTTTGACAAAAGAGCATCTTGCGGACTGGATGCTGCCTCCTCGGCGCAGTCCAGGGCCGCCTGCCGTGAGGCACATAAACGGTTGGCAACGGTTGGAGAGGTCGAGCGACTGGAGCGCTCCCTGACAGAGGTGGGTCCCTATGACCCCCTCCGTAGATATGGCATCAGCCAAAAAATTGTTTCTACGGTGGCGACGAAGTCGAGTGCAGGCCTAAAGGGCGACTATGTGCGGGCCCTAAAATCGGCCGCCTCCTCCATGGAGGAAGTAATGGTGGAGGTGTTGGAGCGCACCAAGGATGGGGAGACGGAAGGTCTGCGCAAATCGGTGGACCTGCTGCACGCCCGACTGGCCCAAATCAGCGCGGAGAACGGTCATCTTCGCGCTGAGAACGGGCAGATGAAGGTGGACTTGGCCGAGTTGCGCACACTGGTCAACGACCTAATCGAGAAGCAGTGCAACTCGGCCCCTGTACCTACTCCGCTCGAGACCGAAGAGGCCAATGAGGCCGAGGAGCTGAGGCGGCAGCTCCTAATACAGGAGGCACGTAGCTCCAACGTGGAGCGCGCGAGACCGCCCCTCGCCCATGAAGCGAAAAGCAGTGCGCCTACCTACACCTGCGGCTGCGGGGGTGCCGGCACCCACGGCCCCTACAAGAAAACCGGCGTCCGCTCCTGCCCCGCCCCAGCCTGCGAAAGCAGGGCCCGGCAGGAGCCGGACAAAGAAGAAGGGAGGCGTCAACGCCGCCAAACCGGCACTGACCCCCCAGCCCGCCCACTGCCCCCCGCCCCGGCCAACATGGATGAGGCCTGGACGACGGTAGTGCGGCGTGGGCCCAAAAAGGTGGCGGCGCCTCCTGCGCCACGCCCCAAGCCCACCCCTGCGGCCGCCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAACTGGTAGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGTGGCGGCGTGAATGTGGACGCCCTCGGCGTGGAGGGGGGCATCAAGGTCCGGCAGACGGCCAACGGGGCTCGTCTTATAGAGTGCCCCGGCCCCAACACAAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATCCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGGGAAGTAAAAATCACGGGCCTCGACGAGTGCGCCACGAAAGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGCGACGTACTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGGTAGTAACGGCGAACCTCCTGGCCACCCCTCCGCAGGGTCGGCCTTCGGACAGCCCTGGATGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGATCTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAGTCCGCCCCCTCCTCTACCAAAACGAGGAGGGGCGGCAAGAAAAATAAAAAGAAGGAGAGGCCGGCTGCAATAAGGGCAGCCGGCGAGTCAGTTCCCGCCGCGGCACCAGACGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGTAGCCCCGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGCGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGGAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTTGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGTTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATTGTTACGGCACTCTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAGGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTATCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGAGTGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGATGTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTTGAACTGGATGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGACTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGAAGGGCGCCCCAGCGAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGTAG
Protein
MAGFRALSHQPTSSDGEVKKKIRGYLPLRGGESLRAVERSAARCPTVSGGGKHCHDEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFVDSARQRTRRKRKSARQPASVPPSDSSEGEPTSAKYLALAEGPATAAASPATGFDKRASCGLDAASSAQSRAACREAHKRLATVGEVERLERSLTEVGPYDPLRRYGISQKIVSTVATKSSAGLKGDYVRALKSAASSMEEVMVEVLERTKDGETEGLRKSVDLLHARLAQISAENGHLRAENGQMKVDLAELRTLVNDLIEKQCNSAPVPTPLETEEANEAEELRRQLLIQEARSSNVERARPPLAHEAKSSAPTYTCGCGGAGTHGPYKKTGVRSCPAPACESRARQEPDKEEGRRQRRQTGTDPPARPLPPAPANMDEAWTTVVRRGPKKVAAPPAPRPKPTPAAAAPRQEGRAEPRGRTGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGIKVRQTANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTAWARCPVVTANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKNKKKERPAAIRAAGESVPAAAPDEPQGGTDEGAMDVAPSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGESHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDCFRGTMANICDAAMPRVGPEHHVGVRSGGRPRSRDSTAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVTALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGVMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALMFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGKGAPAKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTIS

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
1WDU     E-value=3.69033e-08,     Score=144

Ontologies

Topology

Length:
1624
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.45018
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1624
 
 

Population Genetic Test Statistics

Pi
14.460474
Theta
148.741946
Tajima's D
-1.512945
CLR
1439.767789
CSRT
0.0585970701464927
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号