SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14474
Annotation
reverse_transcriptase_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 4.028
 

Sequence

CDS
ATGACAAACAACAACAAAAACGAGCAGGAAAACAATGTGACTGATTTACATAATCCAAATATCCCATGGAAACGAATGCCAAACCAAAAAAGGAACCGTTCTCCTGAGGAAAATTCGCTTTCTAAATCTAATGAAGCCAAAAGGTTACATACAAGAAACCAACTGATCAGCCAAAACAGAGATATTACTGAATCTACAAGTAGACAAAGTCCAGAAATAGAAACAAGTAATCGTTACTCAATATTAGATGTTGAAGCTGATGACTCGGCTCTACAAAAGAAGACCCCCAAACCGCCACCCATTATACTATATGGTATTGAAGACCTTGCCAAATTAACAGAATTAATAGAACAAGTGTTGGAAAAGAATGACTACACCTTTAAAGTATCATCTAAAGACCAACTCATCATATCCTCTGCCACAATTGACAAGTATAAAATCCTTATAGAGCATATCAGAGCTAGAGGGCTAATAGGCCATACATTCACACGAAAGGATCAAAAATGTATGCGGATAGTAATCAAACATCTACACTTTAGCACACCTAAAGATGCCATCATTGATGCAATAGAGAAGACAGGTAACAAAGTACAAGGAGAGATCGTCACTGCACGAAAACCTGGCACCAAAGAACCATTAAATACATTTTTTGTCAATGTAGCATCCCATGAAAATAATAAACATGTCAAAGATATAAAATTCATTTACCACCAAAAAGTAAAAATAGAAGACCCGAAACGAAAGACAACTATAGTACAGTGTACAAGGTGTCAACAATATGGGCACAGCAAAAATTATTGTATGCGCCCATATAGATGCGTAAAATGTGCTGGTCCACATAAGACAACATTGTGCACTATTGACAAAAATACCCCAGCTGTGTGCATTCTCTGCTCAGGAAGTCATCCTGCTAGTTACAAAGGATGTATGGTATACAAAGAAATTCTTACAAGGAAGAAAATGGCTAATAAACCTAACACGAAATATAAAATCAACTCTCTTGCTACAAAAGATCCAACAGTATATAACGATACCCAAATAGAAACTGAAAAAGAAAGAAAAGTAAAAACCACCAAACAGCATGCTACTGTTCAAGAAAGTTTAAAACAATACAGTGAGGTTGTTAAAAAAGGTCTTGAAAATTCATCTCTCAAGAATCATACTTATGATCCAATCAAATATAAAAAAGATACGCAGGATCATCAGACATCATGGCCTTTAGATACCAGTACAGAAACACAGAGATCAAATACATACATAAATAGACATCAGCCAAGAACACAAAAACCTATGACAAAATACAACCATGACAATATGTCACAGAGAACACAATTAAAAAAAATAGATAGCGACAATGACACTCGAGAGCAAATACTTATGTTAGAAAAGGTCATAACAAGACAATCTGAAAGAATTGACCAACTTATAACACAGCTAAACACAATGATGAACCTTATCATTACACTCGAGCTAGAAATTTTGCTCAAGCTTAATAAAATAGACGTTGCGCTAATATCAGAAACTCATCTTAATGACAATAGAACAATTTTGATAGATAACTATAGTGTATATAACACAAATCATCCTGATGGAACTTCACATGGAGGAACCGCCGTTCTTATTAAAAATAACATAAGGCATAATGTACACAGTGCTTTTCGAGAGGAATGGCTCCAAGCTACTACTATAACTATAAACGAAAAGTTTGGGCCTATTAACATCAGTGCTATCTACTGTCCACCAAAACACAATCCTAAGCAAGATATGTTTAATAAATTCTTCAACACTTTGGGCAATAAATTTATAAGCGGAGGTGATTGGAACTGCAAGAATACATTCTGGGGATCACGGTTGACAACTACTAAGGGACGTGAACTGAAAAAAAGTGCTGATGATTGCAAGCTAACAATCCTTGGAACAGGTGAACCTACCTACTGGCCAACAGATACAAATAGACTTCCAGATCTGGTGGACTTTTTTATAATAAAGGGTCTTTCATATGTATATTTTGAAGTTGAGTCATCACTTGATTCTGTGTCGGATCACACTCCTGTCATAGCAACATTTAGCATCTCACCTATACAAAAAGAACAAAAAGAAGTACTATATAATTATAAAACAGACTGGAACTCATTCAGCGATTATCTAGAGGAAGAAATTAAACTTAGTGTTAAACTTAAAACAGAAGAAGATATAGATGAGGCAACATTTTATATCACAAACCTCATTCAAGTGGCTGCGTGGCATTCCACTCCAAAATTAAGCGATCATACTGTTAGTAATAATATACCTATGGAAATACGCCACAAACTTCAAGTAAAGAGAAAGCTAAGAAGGCAACTCCACATGACAAGATCCGATACAGACAGAAAAGAATTTAATAAAATCTCAAGAGAACTAAAAGAACTAATCAATGAATCTGTCAACTCAGCATTTCATCATAAAATATCAGGGCTCTCAGCATACAAGAAGGACAATTATTCTTTATGGAAAATCACCAAAAACTTCAAAAAACCTAAAAGCCATATTCCACCAATGAGGAAATCGCCAACCGACCCTTGGGCCAAGAGTACAACTGAAAAAGCTGAGCTATTTGCAAATTACTTGTATGAAATATTTGCCCCTAACCTATCACCAATGGAGGACTATGAAAAAGAAGTTGATGTCATGATTAATAGTGACCAGCAACTATCCCTGCCACTCAAATCCGTCACCCCCAGGGAACTTACGCAATGTATACAGTCTCTTAAAAATAAAAAAGCTCCTGGTTTTGATTTAATAACTGGTGAGGTACTTAAAAAATTGCCCAAAAAAGTAATAATATTTCTAACAATGTTATTCAATGCTATCCTCAGAGTACATTATTACCCAAAACTCTGGAAAATAGCACAAGTCTGCATGGTTATAAAGCCTGGAAAACCAGCGTCAGATCCAAGTTCATATAAGCCCATAAGTCTTCTACCTGTGTTGTCTAAGGTGTTTGAAACGGTATTTCTAGTCGAACAAGTACACAGAGTAGTTCATAAAATTCGACAATCCTTAGAAAAGAAGGAATACTGTTCTGCGGCATTTATTGACATCAAGCAAGCTTTCGATAAAGTCTGGCATAAGGGATTACTATATAAATTGAAAACCCTCCTACCGAATTCTTTTTTCATGCTCCTGAGATCCTACTTAAAACACAGAAAATTCCAAGTCAAATTTGGAGAGGACTGTTCGAAGCTGTATAATATTAACGCCTCCGTACCCCAGGGATCAGTGTTTGGTCCGGTCCTGCCTCAATCCCAAGATGTTGTAACTGCGACTTACGCTGACGATACAGCTTGTCTGGCAAGTGACATAGATCCACATAATGCATCATTACAACTACAAGTACAGCTTGACAAAGTAGATGCTTGGTTGCAGAGATGGCGATTAAAACCTAGTGTAACTAAGTCAACGCAGGTAACATTCACCCTCCGGAAAGGTGTCTGTGTCCCTGTTTACATGGAAGGTAAAGCTTTACCAAATGCCGACTCTGTGAAATACTTGGGATTACACCATATAAAAGCAAAAAAACGAGAAGCGAACTTGCAATTTCTCTCTTTGAATTGGTTACTGGGACGCCGGTCTCCACTGTCACTAAGTAACAAACTCCTGGTCTACAAAGCGATTATAAAACCTGTCTGGACTTATGGAATAGAACTGTGGGGTTCCGCTAGCAACTCGAATATCGAGATCTTACAGAGATTCCAGAACATTGCTCTTAGAACTATCTCAAACGCGCATTGGTTTGTAAGAAATAGTGAGATTCACGAATATTTAGAAATGCCGACTGTTCGAGAGGAAGTCAACAAGAACAGCAAGAGATATAAGGAAAGACTAAATGAGCACTCAAATGAATTGGCAAGGTGCCTGCTAGACACAACTGGAGATGGGAAACGTTTAAAAAGATGGCAAATTTTAGACTTAGACCAAAGATACTAA
Protein
MTNNNKNEQENNVTDLHNPNIPWKRMPNQKRNRSPEENSLSKSNEAKRLHTRNQLISQNRDITESTSRQSPEIETSNRYSILDVEADDSALQKKTPKPPPIILYGIEDLAKLTELIEQVLEKNDYTFKVSSKDQLIISSATIDKYKILIEHIRARGLIGHTFTRKDQKCMRIVIKHLHFSTPKDAIIDAIEKTGNKVQGEIVTARKPGTKEPLNTFFVNVASHENNKHVKDIKFIYHQKVKIEDPKRKTTIVQCTRCQQYGHSKNYCMRPYRCVKCAGPHKTTLCTIDKNTPAVCILCSGSHPASYKGCMVYKEILTRKKMANKPNTKYKINSLATKDPTVYNDTQIETEKERKVKTTKQHATVQESLKQYSEVVKKGLENSSLKNHTYDPIKYKKDTQDHQTSWPLDTSTETQRSNTYINRHQPRTQKPMTKYNHDNMSQRTQLKKIDSDNDTREQILMLEKVITRQSERIDQLITQLNTMMNLIITLELEILLKLNKIDVALISETHLNDNRTILIDNYSVYNTNHPDGTSHGGTAVLIKNNIRHNVHSAFREEWLQATTITINEKFGPINISAIYCPPKHNPKQDMFNKFFNTLGNKFISGGDWNCKNTFWGSRLTTTKGRELKKSADDCKLTILGTGEPTYWPTDTNRLPDLVDFFIIKGLSYVYFEVESSLDSVSDHTPVIATFSISPIQKEQKEVLYNYKTDWNSFSDYLEEEIKLSVKLKTEEDIDEATFYITNLIQVAAWHSTPKLSDHTVSNNIPMEIRHKLQVKRKLRRQLHMTRSDTDRKEFNKISRELKELINESVNSAFHHKISGLSAYKKDNYSLWKITKNFKKPKSHIPPMRKSPTDPWAKSTTEKAELFANYLYEIFAPNLSPMEDYEKEVDVMINSDQQLSLPLKSVTPRELTQCIQSLKNKKAPGFDLITGEVLKKLPKKVIIFLTMLFNAILRVHYYPKLWKIAQVCMVIKPGKPASDPSSYKPISLLPVLSKVFETVFLVEQVHRVVHKIRQSLEKKEYCSAAFIDIKQAFDKVWHKGLLYKLKTLLPNSFFMLLRSYLKHRKFQVKFGEDCSKLYNINASVPQGSVFGPVLPQSQDVVTATYADDTACLASDIDPHNASLQLQVQLDKVDAWLQRWRLKPSVTKSTQVTFTLRKGVCVPVYMEGKALPNADSVKYLGLHHIKAKKREANLQFLSLNWLLGRRSPLSLSNKLLVYKAIIKPVWTYGIELWGSASNSNIEILQRFQNIALRTISNAHWFVRNSEIHEYLEMPTVREEVNKNSKRYKERLNEHSNELARCLLDTTGDGKRLKRWQILDLDQRY

Summary

Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF07530   PRE_C2HC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
1321
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.21955
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00013
outside
1  -  1321
 
 

Population Genetic Test Statistics

Pi
338.631391
Theta
195.011007
Tajima's D
2.258002
CLR
0.064146
CSRT
0.914154292285386
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号