SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14463
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.139 Nuclear   Reliability : 1.399
 

Sequence

CDS
ATGTCCAGTTTGCAAAGAGTAATACCCCAGGAGGGTACCCGCCAAGCGGGAGAATCCCTCCGTACTACCGACTCGTCGGTAGTGCGCAGCCCCTCGTATTCTGGGGGGGGCACAAACTGCACTGAGATAAGGTCCGAGAAGGACGGGGTTAAAAAAGGAGCAGGGTCCGGGAAGGACGTAAGTAGGAAGAACAGGTCCGCGAAGGACGTAGTAGCAGAAGGGTCTGTTAAGGACAGTGAGGGGAGATCGTCCAGAACCACTCTTGTGTCGGATGATAGCATGACCACAGCTGGGTCGGCCCACTCGTCAGCCCGCTCTTCGCCGACACGCAGACAGCGAAAAAGAGTCCTGACGATCAGCAGTGATGAGTTTGGAAGCAGCTCCGGCTCGGATGAAACAGCTACTACTGGTAAATGTGGTGTCAAGCCGCAATCGAAGAGAGGTCGCGGTCGTCCGACGACCACTGGTCAGTACGGTCTGACTGCGGACGAACAGGTGTATCTTAAAGCTCAGCGCTCTGAGATAAAGGATGCCGGTAGCATGCGTAGTATGCGCGAATTAAGAAGCGCAAAAATCATGGAAGGGAGCTCTAAGAAAGATCCCGAGTGTCGTCTGAAGGAGAGTGCCGCGATGGCTCTGAAGGTATGTAGTAAGCCCGGAAACCTGAAGGGCACGTATCAACGTGTCCTAAAGGAATTGGCGGTGACAATAACGGAAGTCACAGAAGAACTGGCGAACCGCCCCGCGACCGAAGAGATGGAAAAGCTGCGTGCGGTAAACGCCTGTCAGCAGGAAGAGATTTTACAGCTCCGGCAGGAGCTGCAGAAGGTGCATAAGGAGCTGGCGCGCATATCACAGGCATTGACGTTGTCCAATCCAGTCGAAACCCCAGCCCCAGCTTCAACCACAGAGGACCAGGAGGAGTTGCGTGTCCAACGCATTATGCGTGCCGTTGGCACCATGCTTGACGCTCGCATTGCGAGTCTGGAGATGCGGCTACCCCCGGAGCCTCGCATCAGGCCACCCTTAGCGGCGGATAAGCGGAAGAGCTGTGAGAAATCGCCGAATTCTCCTCTCCTTGTTGACGCTACGCTGGAGTCGACAACGGCACAAGCAGCACTACCGCCCACGGTGAACAAGAAGACACGAGGCCCTAGACAAAAGGCCACAGTGTTAGCGCCTCCACCCGAACCGTATGGCTTCCCTCCGGCTCCAGCTGTCGTAACCGAAAGCTGGTCTACGGTCACCCGTAGGCGCGCTAAGCCGAGGGGGGAGACCGTGAGAACGGCCACAGCCGTTCCACCCACTAGGGTGTCGGAGAAAGTCCCGTCTTCAAAGAAGAGGACAAAGAAGCGGCTCCGAGCTCCGCGTTCTCAGGCTGTGGTATTAAAACTACAGCCTGAGGCGATAAATAGCGGTCTCACATATCGGCTCATCCTTGCGGACGCGAGGGCGAAGCTCGACCTAGAATCGCTGGGTATTCCGCTCCAGAGGATCCGATCCTCTCTGACAGGTGCCAAGGTCCTGGTGGTGGACGGAGACGATCAAGTGGAGAAGGCCAACCTCCTGGCGAGCAAACTGAAAGAGATTCTGCCCGCTGAGGGCGTCGAGGTCTCCAGGCCATTGGTGACTGCAGCGATGCGCATCAGTGGCCTCGACGACTCGATATCGCGTGAAGAAATCGCTGATGAGCTCGCCAAAATTGGGGGGTGTCCACCCGAGACTATCAAGATCGGGGAAATAAAAACCGGTCCAGGCGGGATGGGACAAGTCTTAGTTCGTTGTCCGATCTCAACAGCGGCGAAAATCGCAGCAGTTCCCAAGCTAAGGATTGGCTGGAGCGTGCTCCGCGCTCATTTGCTGGAGCCCAGGAGGCTACAGAGACAACGTCGGCAGGATCTCGCGTCGCTTGAGGGCGGGAACCTCAATCACTCCGCCAGAGCTCAAGATCTTTTGTTTCAGAGCATGGCGGAAGGGTTGACTCACCTTGCGGTGGTCGCAGAGCCGTACCGGGTCCTTTTGGGTCCCGATTGGGCAGGTGACCTTGACGGCCGGGTTGCCATTGTCAGGCGTGGCTGTGTGGGTGCTCCGCCCGGATTCGACCTCGTTGAAAGGGGTCGCGGCTTCGTGGCCGTCCTCTGGGCCGAGATGATCGTGGTGGGAGTATACTTCTCCCCCAACAGGACGCTCGCCGAGTTTGAGGGCCTCCTCCTTGAGCTCGGTCGCGTCATTGGGAGGTCACATTCCCGTCGGATTCTCGTCCTTGGGGACCACAATGCCAAGTCATTGGCTTGGGGTTCCTCGAGGACGTGCCCCAGAGGAACGGCGGTGGAGGAGTGGCTGGTCGGAGGCGGCCTCGTCATTCTGAATCGTGGCACGGAACTTACGTGCGTGAGACGATTAGGCGGGTCCGTGGTGGACGTCACGTTCGCATCTCCCGATGTCGCGAGTCGCATCCGTGGTTGGACGGTGATGGTTGGTGAGGAGACGCTTTCCGACCATCGCTACATCCGTTTCAGCATTGCTGTAGCCCCAGAAGTGACATCAACTTCTTTATTCTGCGGCGGCGACGTGGAGGGTCCTCGTTGGGCCCAGAAGCGTCTCGATGTCGAACGGCTGAATGAGGCGGCTGTCGTCCAGGCCTGGCGCCTCGATTCCCTCGGTGAGCCGATGAATGTAAGCGTGGGGGCGGAGCGTATGCGCGAGGCAATGTCGCGGGTATGCGATGCCGCTATGCCTCGCGTCAGAGCTCTAGCTCCTAAGCGCCGCGTATACTGGTGGACTGATGAGATCGCCAACCTGCGCCAGTCCTGCAACGTCAGTCGACGTGCGTACCAACGAAGCCGACGTCGAAGGACGCATCGTGACCCTGAGGAGGAGGACCGCCTTTATGAGGTGTACAGAACGGAGGTGAGGGCCCTTTGCACAGCCATCAGAGAGGCGAAGGAAACCGCTTGGAATGATCTGCTCGCCTCGCTTGATCGCGATCCGTGGGGGCGGCCCTACAGGCTAGCGCGCAATGCGCTTCGCCCATGGGCTCCCCCTACGACCAGCACACTGACGCCCGAGACATTGCACCGGGTGGTCGGGGGTCTATTTCCGGACTCATCCCGAACGGCCTTCATCCCCCCTGTAATGGCAACGGCGCAGGTCGCTGACGGCGGAGAGCTGGAAGGTGTGTCCCAGGCGGAATTTGAGGCGGCAGTGGCGAGGATGCGCGTGAAGCGTACAGCACCAGGCCCCGACGGCCTGTCGAGTCGAGCATGGGCTCTCGCTTTAACTGAGGATGGTTTGGGACCTGCACTTCGAAGGCTGTTTAGCAGGTGCCTCCGCGAGGGCAGGTTCCCGGAGCCGTGGCGCACGGGCCGGCTGGTGCTTATCCCGAAGGACGGTCGCCCTAGAGACGAGCCCTCCGGGTATCGCCCGATAGTAGTGTTGGACGAGGCCGGTAAGCTCCTTGAGCGTGTGGTTGCCGGGCGTCTTGTTCAGCACCTGGAGAACATTGGGCCGGATCTCGCGTCCAACCAATATGGCTTCCGGAGAGGTCGGTCGACCGTGGACGCGGTCTTACGGGTCCGCGATCTTTCCGACCAGGCGTGCTCTGGGGGAGGTGTACTGTTGGCTGTGTCGATTGATATTGCCAACGCTTTCAACACGATCCCCTGGAGCACGATCGTGGAGTCATTACGGTTTCACCGCGTCCCCACCGGTCTCCGTAATTTGATTGAGGATTATCTCTCGGGGCGGGCGGTGATCTTCCCCGAGTGGAGTGGGTGGGGACGAAAAACAGTGTCGCGTGGGGTTCCACAAGGGTCGGTATTGGGTCCACTCCTTTGGAATATAGGCTTTGACTGGGTCCTCCGCGGGGCTAACCTGCCTGGCGTCGAAGTGATTTGCTACGCTGACGACACGCTGGTGACGGCTCGCGGAGACGACTACCGGTCAGCAGCCGTCCTGGTTGTGGCTGCAGTGGCAACTGTGGTAAGACGAATAAAGAGACTCGGCCTCGAGGTGGCCCTCCAAAAATCCGAAGCAGTGTGCTTCCACTCAGCTCGGAAAGGGCCACCTCATGGCGCGAATCTCGTAGTCGGGGGTGTCACCATTGCTGTCCAGCCGAAGCTCAAGTATTTGGGCCTCGTGCTGGACAGCAAATGGAGATTCGACCACCATTTTAAAGCGCTGGTTCCGAGGCTCATGGGGGCGGCAGGTGCGCTGACCCGTCTTCTTCCCAACGTCGGAGGATGCAGCGCCGGTACTCGGCGACTGTACCTTGGGGTGGTGCGCAGTATGGCCCTGTACGGTGCTCCCGTGTGGTCGCCCGCACTCTCCGCGAGAAACGCGGCTCTGCTGCATAGAGCTCAGCGGGCGCTTGCGGTGAGGGTCATCAGGGGGTACCGCACCATCTCTCAAGATGTGGCCTGCGCTCTCGCCGGATCCCTACCCTGGGACCTCGAGGCCGAAATCTTGGCTGCGGTATATCGGCGTAAGGCGCAGGCCTTGAGTCGGGGGCGGTCGCCCGGCCCGTCGGCTGTCGGTCGGTGGAGGCGTGCTGCGCGTCATGTAGCATACGCTAAGTGGAGAGAGCGATTGCTGAAAGAACTTGGCCAAACTTCGGTCACCCGCCGGCGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTCGGATCGGCGTCACGGCGTACTCTCCTTTCACCTTGCGCAGGTCCTCTCGGGACATGGCTGTTTCGGGAGGTACCTGTGGAAGGTCTGCAGGAGAGAGCCACACCCGGGCTGCCACCAGTGCGGGCACCCGGACGATGACGCGCAGCACGCGCTCGAAACGTGCCCGCGTTGGGAGCACTCGCGGCGAGATCTCGTCGCGGTGCTGGGGAGAAACCTCTCCCTGCCGGCTGTCGTCGCCCGCATGTTAGAGGATCAGGGCTCGTGGGAGGCCATGGCCAGGTTTTGTGACCTGGTAATGGCGTCCCGTGAGGCTGAGGAGCGTGAAAGGGAGTGGGATCCCTCTTCAGCACCTCAGCGCAGAAGGCGGGATGGCCGGCGCGGGCGTGAAGCTCCCGCTCAGCCCCCGTAG
Protein
MSSLQRVIPQEGTRQAGESLRTTDSSVVRSPSYSGGGTNCTEIRSEKDGVKKGAGSGKDVSRKNRSAKDVVAEGSVKDSEGRSSRTTLVSDDSMTTAGSAHSSARSSPTRRQRKRVLTISSDEFGSSSGSDETATTGKCGVKPQSKRGRGRPTTTGQYGLTADEQVYLKAQRSEIKDAGSMRSMRELRSAKIMEGSSKKDPECRLKESAAMALKVCSKPGNLKGTYQRVLKELAVTITEVTEELANRPATEEMEKLRAVNACQQEEILQLRQELQKVHKELARISQALTLSNPVETPAPASTTEDQEELRVQRIMRAVGTMLDARIASLEMRLPPEPRIRPPLAADKRKSCEKSPNSPLLVDATLESTTAQAALPPTVNKKTRGPRQKATVLAPPPEPYGFPPAPAVVTESWSTVTRRRAKPRGETVRTATAVPPTRVSEKVPSSKKRTKKRLRAPRSQAVVLKLQPEAINSGLTYRLILADARAKLDLESLGIPLQRIRSSLTGAKVLVVDGDDQVEKANLLASKLKEILPAEGVEVSRPLVTAAMRISGLDDSISREEIADELAKIGGCPPETIKIGEIKTGPGGMGQVLVRCPISTAAKIAAVPKLRIGWSVLRAHLLEPRRLQRQRRQDLASLEGGNLNHSARAQDLLFQSMAEGLTHLAVVAEPYRVLLGPDWAGDLDGRVAIVRRGCVGAPPGFDLVERGRGFVAVLWAEMIVVGVYFSPNRTLAEFEGLLLELGRVIGRSHSRRILVLGDHNAKSLAWGSSRTCPRGTAVEEWLVGGGLVILNRGTELTCVRRLGGSVVDVTFASPDVASRIRGWTVMVGEETLSDHRYIRFSIAVAPEVTSTSLFCGGDVEGPRWAQKRLDVERLNEAAVVQAWRLDSLGEPMNVSVGAERMREAMSRVCDAAMPRVRALAPKRRVYWWTDEIANLRQSCNVSRRAYQRSRRRRTHRDPEEEDRLYEVYRTEVRALCTAIREAKETAWNDLLASLDRDPWGRPYRLARNALRPWAPPTTSTLTPETLHRVVGGLFPDSSRTAFIPPVMATAQVADGGELEGVSQAEFEAAVARMRVKRTAPGPDGLSSRAWALALTEDGLGPALRRLFSRCLREGRFPEPWRTGRLVLIPKDGRPRDEPSGYRPIVVLDEAGKLLERVVAGRLVQHLENIGPDLASNQYGFRRGRSTVDAVLRVRDLSDQACSGGGVLLAVSIDIANAFNTIPWSTIVESLRFHRVPTGLRNLIEDYLSGRAVIFPEWSGWGRKTVSRGVPQGSVLGPLLWNIGFDWVLRGANLPGVEVICYADDTLVTARGDDYRSAAVLVVAAVATVVRRIKRLGLEVALQKSEAVCFHSARKGPPHGANLVVGGVTIAVQPKLKYLGLVLDSKWRFDHHFKALVPRLMGAAGALTRLLPNVGGCSAGTRRLYLGVVRSMALYGAPVWSPALSARNAALLHRAQRALAVRVIRGYRTISQDVACALAGSLPWDLEAEILAAVYRRKAQALSRGRSPGPSAVGRWRRAARHVAYAKWRERLLKELGQTSVTRRRTLEALVPVLEAWSDRRHGVLSFHLAQVLSGHGCFGRYLWKVCRREPHPGCHQCGHPDDDAQHALETCPRWEHSRRDLVAVLGRNLSLPAVVARMLEDQGSWEAMARFCDLVMASREAEEREREWDPSSAPQRRRRDGRRGREAPAQPP

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
1WDU     E-value=3.88837e-07,     Score=136

Ontologies

Topology

Length:
1691
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0434000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1691
 
 

Population Genetic Test Statistics

Pi
1.337788
Theta
1.589177
Tajima's D
-0.626205
CLR
127.659435
CSRT
0.226188690565472
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号