SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14451
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.756
 

Sequence

CDS
ATGATGGACAATTGTGCAAAGTTAGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCAGTGGAAGCACGCTGCCCCACGTATTCTGGGGGGGGCAACAATTGTCAGGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGCGCTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTGCAATCAACCCCACCAGACCATCGGTGGGGAAAAAGAGGGGGCGAAGAAAAACCCCATTGCCATCTTCCAATGACGGCAGCGCGTCATCCTCCGGCACTGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGACTCCGATGGTTTCGGGGTCTGCTGCTGCGTCGGAAGACGCGATGCCTGCTCCCCAGTGGGCACCAGTAAGGAGGAGGGGCGCGGTGTCACCGGCGACGTCGGTGGAGTCGATGTCGACGTCGGCTGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCGCTTGTTAATTTGGGTAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGTTACCGGAAAAGACTCCGGGAGGCAGCCGCCATGGTTAAAACGAGGCTGATCCCCACCATGTCCAAGCTCCATGACTTGGTAGCGAGCCGAGAGGTGGAGAGCAAAGGTCACGTCTCTCAGTTTGACTCCAGAGAGAGTCACATCCCGGGAGACACCCCGGCATTGCGGGGAGGGACTCCCCTGTTGCCGAGGCCCGCGCTGCCATGCACTGGGCCCCCCGCGGGGGCGATGGATACTACTGTGCACTTGCGGTCCGCGATGAGTGCGGTGGCACCCATGCCAGAGCCCACCTCCGAGGCCCCTGTTTCGCTGGCGCCTACTCCTGCGATCCCTCGCCCTCCACGAAGGGTTGAGCTAAGGCCTGCGCCACCTCCGCGGATATCGGCCGCCCCTGCATCTGCACGTAGAGGAAAGCTAAACCCTACGCCAGCGCGGGCTGAGGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCAGCGCTACCGCGGCCCAGGCCTGCAGAGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTCACAGAGGCCATACAACATGGCTGCTGGGACGGAAGAAGTAGACCACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGCATTTCGCGGGCGGTGGCGGTTGAGGTTGGCAAGCACTTTGCCAGCCTCGAGAAGATACTCCGCTCCTCCAATGGCTCCGGAGACTGTGTCCCGGCGCCAACAAACGCCGCCGTCCCGCGGGGCCAGGCCGCCCGGTCGACCTCCACCCCCACCTCATCCACAAGGTTGGCACGACGTGGAGGCCGCAATCAAAATAACAGGGGTACGGGTGCCCAAAATCCTGCCCTGAAATCCCAGCCCCGTCCCCTTCCTCCTCCCCCGTCAACCATGGACGATGGTTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGGTAGGCAACAGACAGAGGCTCTGGCAGCTCCCAGAGGGGGTCGAGCGCTGACCGCTGCAGCCCGAAGCACAGAGCTGGTGGCCGTGGCTGCTCCTCGCGAGAGTCGAGCACCGGCCACCAACAAGAAGCAGAACGCCAAGAAGAGGAAGACGCGCGCAGCGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCAGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCAGGCGCGCGCGGCCGTCAACTTAGCAGAAATCGGGGCAGAGGAAGGCCTCCGCTTCCGGCATACCGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCGGATAGTTCTGGTGTCGCAGACAGACTAGTGGCGACGCTCCGCGTGGCGCTGCCGGAGAATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATCAGGATCACCGGCCTGGACGACTGCGCCACCAAGGAGGAGGTGGCAGCTGCGATAGCCGCCCAAGGTGGATGTGCCTTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGATACTCCGGAGCTAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCTGCCACTTCCTTGGCTACTCCTCCGCCGGGAAGGTCAATGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGGCACGGCCTCGCTAGGTGCACCAGCTTAGTTGACCGCAGCGGTCTATGTTTCCGCTGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCTGGGCGTAGGGCAAACCACCGGGCGGGAGGCAAGGCTTGCTTCCCGTCCGGTGTTAATACTGAACGCAACCGGCGCCGAAAATCAAGGCGCCGGCAGAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAATGTTGCAATCCCCGCTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGACGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGACGATCCCCCCTTGGCGATGGCCTACTGTCGAGTTCGGGCATTTCCTGGACGGAATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAACGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTGTTGGAGAGGTGGGCGAACGTGACCGGCCTCTATTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTGTTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCTAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCAGTTGAGGTCGAGGACGAAGCGAGGTGGTTCCGGGACACGATGCGTCGCATCTGTGACGTGTCGATGCCCCGGATTAGCCCTCGACCTCCCAATCGCCAAGTGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCCAGTGCGCGAGGCATCGCCGCCGTCGCTTGCCGCGGCGCAACGATCCGGTGGCGTTCGCGGTGGTAGAGGCCCAGCTGTACGGCGCATTTCGCGTCGCACAGAGGGCGTTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGCAGAGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCACATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGGGCAGGGGGGATTTGTCGCTCCCGCTATGGGCGCGCCGCCGGAATACGACGGCGACGCCCCTGCTGAGGTGCCCCATATAACAGGGGCGGAGCTCCGTGTGGCAGTACGCAAAATGTGCGCAAAGGACACTGCACCTGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGCAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGTTGGATGAGGTGGGCAAACTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGATCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGTGGAGGCCGTCTGTGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTACATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATATGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGAGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGGCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCAGCGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCTAGCCCTGGCCCTCTAA
Protein
MMDNCAKLVPQEGTARESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPRRSPIAGSMRSALASDSGAINPTRPSVGKKRGRRKTPLPSSNDGSASSSGTEVPEKTMAIEEVTPMVSGSAAASEDAMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVKTRLIPTMSKLHDLVASREVESKGHVSQFDSRESHIPGDTPALRGGTPLLPRPALPCTGPPAGAMDTTVHLRSAMSAVAPMPEPTSEAPVSLAPTPAIPRPPRRVELRPAPPPRISAAPASARRGKLNPTPARAEDIRSPLARMVDEWPALPRPRPAEPPLSPSRAAGSQRPYNMAAGTEEVDHSLPSREEMVACISRAVAVEVGKHFASLEKILRSSNGSGDCVPAPTNAAVPRGQAARSTSTPTSSTRLARRGGRNQNNRGTGAQNPALKSQPRPLPPPPSTMDDGWTEVVKRGKKGRQQTEALAAPRGGRALTAAARSTELVAVAAPRESRAPATNKKQNAKKRKTRAARSAAVVVTLLPAAAEKGLTYNEVMAQARAAVNLAEIGAEEGLRFRHTANGAKLLECPGADSSGVADRLVATLRVALPENEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSMGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSLVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGVNTERNRRRKSRRRQKRRLARGALANVAIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDATIPPWRWPTVEFGHFLDGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANVTGLYLLNRGSVATCVRWQGESVVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADAHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEDEARWFRDTMRRICDVSMPRISPRPPNRQVYWWSPEIAQLRVECVRARRQCARHRRRRLPRRNDPVAFAVVEAQLYGAFRVAQRALQLAIRRAKDQHMQSLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQGQGGFVAPAMGAPPEYDGDAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKQGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLIGVGPDLSAEQYGFREGRSTVDAILRVRALSVEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVARPSPSVVRARRAQSRRSVLEAWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGSDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLALALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=5.31203e-10,     Score=161

Ontologies

Topology

Length:
1878
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14634
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  1878
 
 

Population Genetic Test Statistics

Pi
205.549071
Theta
109.886823
Tajima's D
-1.529003
CLR
0.869091
CSRT
0.0565471726413679
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号