SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14435
Annotation
PREDICTED:_uncharacterized_protein_LOC103309518_[Acyrthosiphon_pisum]
Location in the cell
Nuclear   Reliability : 1.171 PlasmaMembrane   Reliability : 1.129
 

Sequence

CDS
ATGGTAGACACGGGGAGCCAGGCATCGTTTATTACCGAAGCTTGTGTGCAGCGCTTAGGTCTAGCGCGCCGGCATAGCAACGTGCCGGTGTTCGGTATTGGTGACACCGGACCCGTGCATCCAAAAGGTTTAGTTTCGTGTTCCATTGCGCCTAAAGGTCAACAACAACCTGTCATTCCGGTAAATGCGTTAATTTTGCCCGAATTAATTCCAAAAATGCCAAGTGTACCTTTACCGTATACCGGGTGGTCACATTTGAAAAATCTGAAGTTAGCTGATCCGGACTTTCATACGCCCCAGCCTGTTGAAATGTTACTAGGAGCGGATATACTATCCCACGTGTTACTAGGCAACACTATCGTAGGCCCGCCGGGCACGCCGATCGCTATGAATAGTGTGTTCGGTTATTTACTTTTAGGCAAATTAGATTTAGATTCTTCTGTTCCAACTTCATTTCAAGTGTGTTTTAGCTCGTTTGACAACGACAACCTTCAGAGATTTTGGGAGCTGGAATCAATACCAGAGAAACGGAGTTACACTCCAGATGAGGAGTTGTGCGAATCCTTTTTTCAAAAGACGCACACTCGTAATGCGGACGGGCGATACGTGGTCGCCCTCCCGTTTAAGCCCGACGCACCGTCTCTCGGCGAGTCGCGGTCCATTGCGCTAGCTCGGTTTCATAAACTAGAATATCGGTTAGAACGCAACCTCAAGTTGAAGGCTGATTACCACGCTTGTCTCCAGGAATACGTAGACCTCAACCACATGGAGCTCGTCGATGATCAACCTTCAGTTAGTGAAAGTTATTACATTCCGCACCACTGCGTGGTCAAAGAATCGAGTGAGTCGACGCCTACACGTGTGGTGTACGACGCCGGTTGTCGCTCAACTAGTGGGTATTCGCTCAATGACGTTTTACTAACGGGTCCTAAGCTTCACATGGACATAGTGGACGTCCTTCTTAAATTTCGTGTCCATTCAATCGCGCTTACTGCCGACATAAAACAAATGTATCGTAATATACTTGTTCGTGAAAGTGACAAAGATTTTCAGCGTATTGTGTGGCGCACATCACCAGAGCAAACTATTCGTGACTACCGTTTGCGTACAGTCACATTCGGTGTGAAATCGTCACCTTACCTCGCTCTGCGTACAATAAAACAACTCGCTCAAGATGAGGCCGAGCGGTTCAAACTCGCGTCGCCCGTTTTACTTAACGATGTTTTCGTCGACGACGTCGTATCTGGCGAGGACTCTGAAGTCAGCGCACTCGCGCTACAACAAGAGCTGATAGGTATTTGTGGGGCGGCTGGGTTTGAATTGCGCAAATGGCACAGCAACTCGCCAGCGTTACTCGCTGCGGTGCTGCCATCAGAGTCTCATGGTGAGCGGCCGGAGAACGTTCTCTTCGCTGAAATGGAGATCGACAAAAAGGTTAAGGTTCTGGGCTTACAGTGGAACCCTAAATCTGATTCATTCAATTTTAAAGTCCAAGTTTCATCGATTAAGTGTACAAAGCGTGTCATTCTTTCAGAAATAGCAAAAATATACGACCCCCTCGGGCTATTATCACCGGTCACATTGTTTGCCAAACATTTGATTCAACTCTTATGGATAGCCAAAGTCGATTGGGATGAGACGCCGCCTGTTGACATAGTAAATTCGTGGTCTTCTTTCGTTGACGAGCTCCCACTCATCTCACAAATCTCATTTCCGCGTTATATATTTAACAATACCAATCCCGAACCGATACAAATTCACGGTTTTGCTGACGCTTCCGAGAAGGGTTTCGGAGCATGTGTATATATTCGTTACAAAGATCAAGAAGATTTCATTCAAACTCACCTGATTATAGCCAAAACTCGCGTCGCACCGTTGAGTGTGCGTCTCACTATTCCTCGCCTCGAACTAATGGCGGCAGTCCTCTTATCTAAATTAATTGAAAAGGTAATGCTCACTTACAGTGGTCGTGTTCGCTTCGACCAGGTCTACGCTTGGTCCGACGCATCCATCGTGCTAGCATGGCTACACTCATCTCCGCACGAATGGAAAACCTTCGTTTCGAACCGTGTCAGTGAGATTTTGCGCCGCATACCCGCGGACCGCTGGCGCCACGTCCCGTCGGCCGACAATCCCGCCGACGCTGCGTCTCGTGGCCTTTTGCCCGCCGCGCTCGTACAGCATGACTTATGGTACCACGGACCCTCGTGGCTACATCTGGGTCAGAACTCCTGGCCGATTCAAAATCCCGTAAGAGACACGTGCGAAGAAAAACGCAACGTATCGTCCGTTCGCTACGCGCTTTTACAACGCTATTGGATTTTGTCAAGCCGTAACATCGTGCGGCAGCGCATACATCGCTGCGTGCAGTGCTTCCGCGCGCGCCCGACGCACAATCAACCGCGCATGGGACCACTCCCAGCAGTTCGTGTTCGCCCCGCGCGACCGTTTCTAAAGACCGCGGTAGATTTTGCTGGTCCATTTTACGTGCGCGCCAATAAGGACAAGGGCGTCGCCCTTCGTGAAGGCACTGTTGTGGTGGTATGCGACGACCGCTTGCCGCCGTTGCAATGGAGGTTGGCGCGCATCCACGAACTTCATCCCGGCTCGGACAATATCACACGAGTTGTAACCATTAAAATGGGAAATTCCCTTTATAAACGACCCGTGGTTAAAATATGTCCTCTTCCCTTGGAGTAG
Protein
MVDTGSQASFITEACVQRLGLARRHSNVPVFGIGDTGPVHPKGLVSCSIAPKGQQQPVIPVNALILPELIPKMPSVPLPYTGWSHLKNLKLADPDFHTPQPVEMLLGADILSHVLLGNTIVGPPGTPIAMNSVFGYLLLGKLDLDSSVPTSFQVCFSSFDNDNLQRFWELESIPEKRSYTPDEELCESFFQKTHTRNADGRYVVALPFKPDAPSLGESRSIALARFHKLEYRLERNLKLKADYHACLQEYVDLNHMELVDDQPSVSESYYIPHHCVVKESSESTPTRVVYDAGCRSTSGYSLNDVLLTGPKLHMDIVDVLLKFRVHSIALTADIKQMYRNILVRESDKDFQRIVWRTSPEQTIRDYRLRTVTFGVKSSPYLALRTIKQLAQDEAERFKLASPVLLNDVFVDDVVSGEDSEVSALALQQELIGICGAAGFELRKWHSNSPALLAAVLPSESHGERPENVLFAEMEIDKKVKVLGLQWNPKSDSFNFKVQVSSIKCTKRVILSEIAKIYDPLGLLSPVTLFAKHLIQLLWIAKVDWDETPPVDIVNSWSSFVDELPLISQISFPRYIFNNTNPEPIQIHGFADASEKGFGACVYIRYKDQEDFIQTHLIIAKTRVAPLSVRLTIPRLELMAAVLLSKLIEKVMLTYSGRVRFDQVYAWSDASIVLAWLHSSPHEWKTFVSNRVSEILRRIPADRWRHVPSADNPADAASRGLLPAALVQHDLWYHGPSWLHLGQNSWPIQNPVRDTCEEKRNVSSVRYALLQRYWILSSRNIVRQRIHRCVQCFRARPTHNQPRMGPLPAVRVRPARPFLKTAVDFAGPFYVRANKDKGVALREGTVVVVCDDRLPPLQWRLARIHELHPGSDNITRVVTIKMGNSLYKRPVVKICPLPLE

Summary

EMBL
GALX01004947    JAB63519.1    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02001506    + More
ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GGMS01010524    MBY79727.1    ABLF02030854    ABLF02067347    ABLF02006304    ABLF02036268    ABLF02066034    ABLF02035780    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02005684    LBMM01012238    KMQ86334.1    GGMR01017890    MBY30509.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GGMR01002421    MBY15040.1    GALX01000776    JAB67690.1    JXUM01030959    KQ560903    KXJ80414.1    ABLF02008594    LNIX01000036    OXA39969.1    LBMM01009202    KMQ88311.1    LBMM01006539    KMQ90520.1    ABLF02041863    GEBQ01028569    JAT11408.1    GEBQ01015458    JAT24519.1    ABLF02036131    ABLF02041527    ABLF02064049    GEBQ01000825    JAT39152.1    GECZ01008071    JAS61698.1    ABLF02028666    ABLF02066713    GBHO01006408    JAG37196.1    GGMR01011131    MBY23750.1    GGMS01014443    MBY83646.1    GBRD01007977    JAG57844.1    GEZM01054766    GEZM01054765    JAV73410.1    LBMM01010417    KMQ87475.1    RSAL01000327    RVE42512.1    GBHO01044316    JAF99287.1    GAKP01007887    JAC51065.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBHO01000059    JAG43545.1    JAV73413.1    GBHO01028617    JAG14987.1    GGMR01010723    MBY23342.1    LBMM01009964    KMQ87756.1    QOIP01000009    RLU19024.1    LBMM01011051    KMQ87060.1    KZ150008    PZC75149.1    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GBHO01038800    JAG04804.1    GBHO01000060    JAG43544.1    QOIP01000012    RLU15919.1    DNYX01000039    HBK82233.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEZM01054789    JAV73399.1    ABLF02054908    GBHO01007689    JAG35915.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEZM01060254    JAV71154.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    KQ458473    KPJ05885.1    GBHO01000061    JAG43543.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    LBMM01012146    KMQ86385.1    GDHC01019528    JAP99100.1    KK114194    KFM61875.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GBHO01037676    JAG05928.1    GAMC01021577    GAMC01021573    JAB84982.1    LBMM01012077    KMQ86420.1    LBMM01011781    KMQ86634.1    LBMM01011492    KMQ86800.1    ABLF02067195    LBMM01009888    KMQ87813.1    GDHC01002235    JAQ16394.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GBBI01004211    JAC14501.1    GDHC01016272    JAQ02357.1    ABLF02026240    ABLF02055027    LNIX01000002    OXA59522.1    GDHC01014057    JAQ04572.1    LNIX01000007    OXA51382.1    ABLF02042806    GGMR01017803    MBY30422.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GDHC01014268    JAQ04361.1    ABLF02041614    LBMM01009688    KMQ87939.1    LBMM01005506    KMQ91466.1    GGMR01005823    MBY18442.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF00665   rve
PF05380   Peptidase_A17
PF18701   DUF5641
PF03564   DUF1759
PF00078   RVT_1
PF00008   EGF
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR001878   Znf_CCHC       
IPR005312   DUF1759       
IPR036875   Znf_CCHC_sf       
IPR000477   RT_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR000033   LDLR_classB_rpt       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
899
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11593
Exp number, first 60 AAs:
0.00026
Total prob of N-in:
0.00505
outside
1  -  899
 
 

Population Genetic Test Statistics

Pi
312.997196
Theta
173.458609
Tajima's D
0.955567
CLR
121.710833
CSRT
0.648517574121294
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号