SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14392
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 3.267
 

Sequence

CDS
ATGGGGGACGCGGTCATTCTGGCAGGCGATCTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCTCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTAAGAGTTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTGAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAAAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATCGTCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGCACCCCGAACACACCGAGCTAGTCGACAGGGAGGTCGAGCGCAGAGATTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCAAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTCATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCTCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAACACCTCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGTCCTCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTCACTTAAAGACATTCCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCACCAGTAAGTATATGCAGTCGGCGTCAATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGTCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGGCGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTCTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLKELAPTHQAYWRLARTLKSETIVTMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHAHPEHTELVDREVERRDSLPPSDALPPITTSKVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTSAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKTFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESTSKYMQSASMRHFDKAARHENPLIVVAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GBBI01004571    JAC14141.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    ABLF02042518    ABLF02057746    GFTR01008038    JAW08388.1    S59870    AAB26437.2    GGMR01018716    MBY31335.1    RPOV01000134    RPJ78669.1    GGMS01002992    MBY72195.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMR01019198    MBY31817.1    GGMR01003407    MBY16026.1    NEVH01006736    PNF36716.1    GGFL01004957    MBW69135.1    GFTR01008262    JAW08164.1    GGFL01005012    MBW69190.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GEZM01053022    JAV74219.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGFJ01001842    MBW50983.1    ABLF02024246    GGFJ01001843    MBW50984.1    GGFJ01001844    MBW50985.1    NEVH01026386    PNF14434.1    GGFJ01001858    MBW50999.1    ABLF02034467    GFTR01008279    JAW08147.1    GGFJ01001857    MBW50998.1    GFTR01008271    JAW08155.1    KQ973363    EFA13335.2    ABLF02008153    ABLF02008462    ABLF02008464    JRES01000644    KNC29657.1    KK119692    KFM76444.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GEZM01084969    JAV60363.1    NEVH01020940    PNF20481.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    AF456125    AAL57609.1    GEDC01000337    JAS36961.1    GGFJ01001822    MBW50963.1    AY180919    AAN87272.1    GGMR01000676    MBY13295.1    GGMR01012305    MBY24924.1    GFTR01008261    JAW08165.1    ABLF02028535    ABLF02028545    GGMS01000737    MBY69940.1    GGMR01006408    MBY19027.1    GFXV01000908    MBW12713.1    GGMS01017365    MBY86568.1    NEVH01016302    PNF25823.1    NEVH01006721    PNF37225.1    NEVH01022639    PNF18527.1    ABLF02023911    LBMM01013518    KMQ85605.1    GBGD01000389    JAC88500.1    NEVH01011985    PNF31054.1    KQ973412    EFA12510.2    NEVH01009134    PNF33528.1    NWSH01000032    PCG80496.1    NEVH01027074    PNF13841.1    GBBI01003810    JAC14902.1    GFTR01008251    JAW08175.1    GGMS01002955    MBY72158.1    GFXV01007093    MBW18898.1    GBHO01008295    JAG35309.1    NWSH01007753    PCG62823.1    GFTR01008269    JAW08157.1    GBGD01000415    JAC88474.1    ABLF02033757    NEVH01005295    PNF38784.1    ABLF02040174    ABLF02040183    ABLF02055266    DNOY01000259    HBE18313.1    GFTR01008257    JAW08169.1    NEVH01019963    PNF22185.1    ABLF02014118    ABLF02014121    ABLF02054790    NEVH01021205    PNF19912.1    GFTR01008256    JAW08170.1    AY060438    AAL25477.1    GEHC01000968    JAV46677.1    GGMR01016296    MBY28915.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00151239,     Score=102

Ontologies

Topology

Length:
828
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.572820000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00148
outside
1  -  828
 
 

Population Genetic Test Statistics

Pi
2.402423
Theta
2.892618
Tajima's D
-0.93922
CLR
0.094982
CSRT
0.148442577871106
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号