SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14385
Pre Gene Modal
BGIBMGA013290
Annotation
PREDICTED:_irregular_chiasm_C-roughest_protein-like_isoform_X2_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.667
 

Sequence

CDS
ATGGAGCCGCAAGATCAGAGTGCGATAGTGGGATCGCGAGTCACTCTGCCCTGTCGAGTGGAGAACAAGGCTGGGGCGCTTCAGTGGACGAAAGACGACTTCGGGCTCGGCACACACCGGAACCTGAGCGGTTATGACAGATACTCCATGATCGGAAGCGACGAGGAAGGAGATTTCTCCCTCGATATACGAGACGTTACTTTAGAAGATGACGGAAGGTACCAATGCCAAGTTAGTGGCGGGCTAAATGGAGAGCCGGCGATCCGATCGCGGTACGCAAAACTGACAGTCCTAGTAGCTCCTGAGCCTCCGAGGATAATTCAAGGTGCCTTCGTAGAAGCAACGGAAGGTCAATCTCTTGATATCGAATGCGAATCCGTAGGTGGAAAACCGGCTGCCGAGATAACTTGGCTGGACGGTAACCAAGCTGTGGTGAAGAAGAACGTGAAGAGTAAATTGGAGTTGATGGCAGATGGACAAAGATACAAAACAAGGTCGGTTTTGCGGTTGAACCCGAGCAAGGCGTACCACAACCAGACATTCACCTGCCAAGCCCAGAACACAGCTGACAGAGCGCCGAGGATGGCTACGATACATTTTGAGGTGAAATACGTCCCGAAAGTGAATATATCGTTCAGGTCTGGCGTGATCGACGGTAAGATACCGGAGGGTAATGAAGCAAGGATACGGTGTAGCTCCGAATCGAATCCTCCCCCCCGGGCCCACAGGTGGTACATCAACAACAACCCGGTCATAGGAGACTACACTGACGAGATGATTATTTTCAACGTCACAAGGAAACATAACAAGGCTGAAGTGAGATGCGAAATCAGCAATACTGTGGGCACGAGCTCGGCAAAAGTTACACTGAACGTTGCATATCCTCCAATTTTCCGCAATCATCTGCATGACGTCGAGGCGGATATCGGCTCGATTGTGACCCTTAGCTGTGACGTTGATGGGCAGCCGAAGCCGGCGATCAGGTGGCTTCTGAACGAGCCTGGCAGGATCGGGGTTAAAGGAAAATCCCCGAACTTGGAGATAGTTGTGAACAAAGAAACGGCAGGAAAATATATCTGCAAAGCGAGTGTCACCGGATACCCAGAAATCGAGAGTGAAGCTACTGTTTTTATTAAAGGAGCTCCAAAGATAATTTCGAATAGGACTCAGATAGGCGCGGAAGGGGAGACGGTTACAGTTGAATGCCTGACAGAGTCTGTTCCCAAGCCAGACTTCATCAAATGGTTCTTCGAAGGTCGGGAGATCAGTGTGATACAGGATCCGAATTACGCGATACTGCAAGAATCATTGCCCGATGGACTAGTTAAATCTAGTTTGGTGATCAAGGCTAGCCAGTCAAGGCATTTTGGACTTTACAACTGCAGCGTTACGAACGAATACGGTAACGCAAACGCACCGATAATGTTGAAGCCTTTAAAGACCCTTCCACTGTACATAATCCTCATCGGGGTTACGACCGGCATCGTCGTCTTCTCCTCCTTCATAATTCTCCTCGTGGTCTGCCACAGGAGAAGAAGGAAGAAGAGTCAAATGAACGAGAAGCCGGACGTGACCGTCGCGACCGGAGACGCGTACAAAGAGAGCGACAGGAGCTCTAACATCAGCGACCTGAAGCTTCAGTTGCCGCAGAGCGACGCCAGCTACGACCTGGATTACACGAGCTCTGATCGCTCGGACACCAAGGCGCCGGTAGGGCTTCCCCTGGCTGGTCCGGTACCTCTACCTAACATCAGACTAGACGACTTCAATTACAACAATGACTATACTGACCCCGCTTACCACGACTATGGTTATAAGACTCCAGCCGGGTTCGTGTACGACTACCCGCACGGCTACTCGCCCCCGGCGCACCTGCACGTGCATTCCCCCCCGCCGCACGCCAGGTCGCAACAGGGATCTTTGACGCGCAGTATAGACACGGCGTCGACTCTCCCATTGTCAAACAGCAATGGATCGCAAAATAATACGTTGCAACGAACGAACAAGCCCGAGGAAAGCGACGCCATCAACAATTTAGGTCTACCCTCTGGTGGAGAGGCAGGTCCACAAACGCCAATCTATGCGCAACCGAACCCTAGACCGCAGACTGCAGTCGACCCGCGGTACTCGGCTACCTACGGTAATCCATACTTAAGGAATAGTTCAATAGGTTACGGGAATCAGGTGCACACGGCGAAGCCCGCGGCCACGCCCGCACCGCCGCCATACTCCGCCGTCAGGAATTCCGCACCGACAGGTAATGGCGGTCCCGCCCAGGCCACCCACGTGTAG
Protein
MEPQDQSAIVGSRVTLPCRVENKAGALQWTKDDFGLGTHRNLSGYDRYSMIGSDEEGDFSLDIRDVTLEDDGRYQCQVSGGLNGEPAIRSRYAKLTVLVAPEPPRIIQGAFVEATEGQSLDIECESVGGKPAAEITWLDGNQAVVKKNVKSKLELMADGQRYKTRSVLRLNPSKAYHNQTFTCQAQNTADRAPRMATIHFEVKYVPKVNISFRSGVIDGKIPEGNEARIRCSSESNPPPRAHRWYINNNPVIGDYTDEMIIFNVTRKHNKAEVRCEISNTVGTSSAKVTLNVAYPPIFRNHLHDVEADIGSIVTLSCDVDGQPKPAIRWLLNEPGRIGVKGKSPNLEIVVNKETAGKYICKASVTGYPEIESEATVFIKGAPKIISNRTQIGAEGETVTVECLTESVPKPDFIKWFFEGREISVIQDPNYAILQESLPDGLVKSSLVIKASQSRHFGLYNCSVTNEYGNANAPIMLKPLKTLPLYIILIGVTTGIVVFSSFIILLVVCHRRRRKKSQMNEKPDVTVATGDAYKESDRSSNISDLKLQLPQSDASYDLDYTSSDRSDTKAPVGLPLAGPVPLPNIRLDDFNYNNDYTDPAYHDYGYKTPAGFVYDYPHGYSPPAHLHVHSPPPHARSQQGSLTRSIDTASTLPLSNSNGSQNNTLQRTNKPEESDAINNLGLPSGGEAGPQTPIYAQPNPRPQTAVDPRYSATYGNPYLRNSSIGYGNQVHTAKPAATPAPPPYSAVRNSAPTGNGGPAQATHV

Summary

EMBL
NWSH01003040    PCG67071.1    PCG67070.1    PCG67069.1    KQ460254    KPJ16354.1    + More
AGBW02010884    OWR47582.1    KZ150124    PZC73139.1    RSAL01000064    RVE49474.1    KQ458859    KPJ04828.1    NWSH01000121    PCG79332.1    KZ149957    PZC76453.1    KPJ04832.1    KPJ16356.1    KQ971321    KYB28680.1    NWSH01000084    PCG79784.1    EFA00099.1    PZC76455.1    GEZM01036660    GEZM01036657    GEZM01036656    JAV82535.1    GEZM01036659    GEZM01036658    GEZM01036655    JAV82537.1    KYB28679.1    AGBW02010002    OWR49362.1    AGBW02014999    OWR40735.1    APGK01018010    APGK01018011    APGK01018012    APGK01018013    APGK01018014    APGK01018015    KB740064    ENN81761.1    KB632165    ERL89278.1    UFQT01000015    SSX17766.1    GEDC01030411    GEDC01029028    GEDC01027080    GEDC01026323    GEDC01026079    GEDC01021839    GEDC01021418    GEDC01008721    GEDC01004895    JAS06887.1    JAS08270.1    JAS10218.1    JAS10975.1    JAS11219.1    JAS15459.1    JAS15880.1    JAS28577.1    JAS32403.1    GEDC01024142    GEDC01013685    GEDC01006693    JAS13156.1    JAS23613.1    JAS30605.1    JXUM01018125    KQ560503    KXJ82106.1    CH477251    EAT46033.1    GFTR01007564    JAW08862.1    JXJN01008112    AXCN02002013    CCAG010019211    CVRI01000013    CRK89578.1    AAAB01008846    EAA06357.5    JXJN01009949    GAMC01011307    GAMC01011306    GAMC01011305    JAB95248.1    GBHO01024576    GBRD01006502    JAG19028.1    JAG59319.1    CH379064    EDY72610.2    ATLV01013099    KE524840    KFB37203.1    KRT06478.1    KPJ04830.1    DS232044    EDS32996.1    GBXI01005154    JAD09138.1    GDHF01015366    JAI36948.1    CH916370    EDV99713.1    GEBQ01016034    JAT23943.1    GEBQ01005564    JAT34413.1    EAL31716.3    CH933814    EDW05674.2    JRES01001043    KNC25985.1    CRK89536.1    KRT06480.1    CP012528    ALC48822.1    OUUW01000015    SPP88525.1    CH940660    EDW57997.1    EDV99719.1    GAKP01004353    JAC54599.1    JXUM01051192    JXUM01051193    JXUM01051194    JXUM01051195    KQ561678    KXJ77827.1    AXCM01000695    CH954180    EDV45700.1    APCN01001193    JXUM01063713    KQ562264    KXJ76278.1    GAMC01016710    GAMC01016708    JAB89847.1    AF419620    AF419621    AAN31396.1   
Pfam
PF07686   V-set        + More
PF08205   C2-set_2
PF13895   Ig_2
PF07679   I-set
PF06682   SARAF
Interpro
IPR036179   Ig-like_dom_sf        + More
IPR003598   Ig_sub2       
IPR013106   Ig_V-set       
IPR013783   Ig-like_fold       
IPR013162   CD80_C2-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013098   Ig_I-set       
IPR009567   SARAF       
SUPFAM
SSF48726   SSF48726       
Gene 3D
PDB
4OF8     E-value=4.67369e-71,     Score=684

Ontologies

Topology

Length:
763
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.15902
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00047
outside
1  -  484
TMhelix
485  -  507
inside
508  -  763
 
 

Population Genetic Test Statistics

Pi
279.32151
Theta
168.660583
Tajima's D
0.97797
CLR
0.513116
CSRT
0.649167541622919
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号