SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14383
Pre Gene Modal
BGIBMGA013310
Annotation
PREDICTED:_irregular_chiasm_C-roughest_protein-like_isoform_X2_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.231 Nuclear   Reliability : 1.79 PlasmaMembrane   Reliability : 1.103
 

Sequence

CDS
ATGTCGAACTACAGACCGAGGACAACTAGTAGGGATGTGAAACCGTTGTTTCTGTTGTTGCGGACCAAGTATGTGCGTTTTTACGTGTTCAGTGCGATATTTATCAGTTCGTTCAGTGTTTGTTGCGGCTTCGCGGAGCAGAAGTTCGCCATGGAGCCACAGGATCAGACCGCCGTTATTGGCTCGAGGGTGACACTGCCATGCAGAGTTGAAAACAAGGTGGGTCAACTCCAGTGGACAAAGGATGATTTCGGCCTTGGACTCCACAGAGAGTTGAGCGGCTATGACCGGTATAAGATGATCGGTAGCGACGAGGAAGGTGACTACTCTTTGGACATCAGAGACGTAAATTTAGATGACGACGCCAAATACCAGTGCCAAGTCAGCTCAGGAGTTAAAGGTGAACCAGCAATTAGGTCACGATACGCCCGTCTCACCGTGCTAGTTCCGCCGGAACCACCGAAAATACTGCAAGGGAATTTCTACTCAACCACCGAAGACAGAAATATCAAATTGGAATGCGTGTCGGTCGGCGGAAAGCCGCCCGCTGAGATAACGTGGGTGGATAGCAACGCCGGAGTTTTGACTCAAGGTGTCACTTACACCGTGGAGCCCCTGTCTGACGGACAAAGGTTTACTGCGAGGTCAATTATAAATATGACGCCCAAGAAGGAACATCACAACCAAACTTTCATTTGTCAAGCTCAGAACACAGCGGACCGGGCGTACAGGGCGGCCAGTATACAAATCGAGGTGAAATACGCTCCTAAAGTGAAGATTTACATAAAATCAAGAGTCAATGGGAGAATTCCCGAAGGGGATGATGTAACAATAGGCTGCAAAGCAGACGCCAATCCAACGAATCTAACTTACAAATGGTATATAAATGAGGAATCTATAAATGGAAACACTACTGAATTGAAAATCTACAACATATCAAGAAAGTACCACGACGCAATAGTGAAATGCGTTGTTTACAACGACGTCGGAAAGACTGAGGAAGAGGAGACCTTGGAGATTACTTATGCGCCATCCTTTCGCCATCTCCCCAAGGACGTCGAAGCCGAAGTTGGCACTAGCGTAACCTTGAGTTGCGATGTGGATAGCTACCCGAATCCAGAGATACGATGGCTCCATCATGAAGAAGACCAGACTATTCGCGTGGGACGCACCCCTAATTTAACTCTCACAGTGGATACCCACACATCAGGGAGGTATCTTTGTAAAGCCAGCGTGGACGGATTCCCTGAAATAGAAGCAGAGGCGTCGGTGTTCATTAAAGGTCCTCCGAAGATAATATCGAATCAGACACAATTCGGTACCCAGGGGGACACAGTGAACATTGAGTGTGCAGCCTTCGCCGTGCCGAGGATAGACAGTATTATCTGGACTTTTAACGGAAGAGAAATAGATTCGTTGCATGATCAGGACTACGCATTCCTCGAAGATCTACAATCAGGAGGCATAGTTAACTCTACGCTAATAATTCGAGAGAGCCAATACAAGCACTTCGGCGTGTACAAATGTAACGTGTCTAATGACTATGGCAATGACTATTTGGAGATTACCGTGACTGCTAAAGAGGCCCTTCCACTGCTGGTGATAATTTTCAGCGTAACCACTTGCACGATTGCCGTGGTTTGCCTAACTATGCTGATAATAATTTGCCAAAGAAAGCAAAAAAGGGGAAAGCAGAGTCAAGTCGCCGAGAAGCCAGATGTGACTGTCACGGCCCAAGAGCTTTTCAAGGATAACGACAGGAACTCAAACATTAGCGACCTGAAGCTTGAACTAAGACAGGCCAACGGTAGCTGTGAAATTGATTATTCCAACACCGGCTCAGATAGTACCTTGTGTTCTAATGCCAAATTAGGCAGCGGCATTCCATTGGCCGGTTCTGTTCCTTTAGCATCTATGAACCAGAATAACTATCAGCCGTACAGATATAGTAACGATTACACAGATCCTGCTTACGCTGATTGTTACAAGGTCAATGGCTTTAACAACGGCTATCAGACGTATGTTCATTATGGACATGATTACACGCCTGGTTCGTTGAGGGTGCAGTCGCCGACTTTGGCCAGCGATAAACTCACCCCTAACAGGTCTATAAACGGAAGTTTACCTAGAAGTGTCGATACGCCATCGACGGTTCAATACAACGTAGGGAACGGATCCCAAAATAACTCGTTGCAGCGTTCAACAAAACGGCAAGACAGCAGCAGCGCATTGAATAACCTGGGCCTTCCTACAGCAGAGGTAAGCCGCGTGCCTAATGGTGGCATACATGGTGTTGATATAAGATACGCAGCAACATATGGGAATCCACATTTACGTTCTGGAGGTGGACTGGGTTTCAATACTGTTAACACTGCCAAACCGGCGTCCACTCCAGCGCCACCACCTTATTCGTCTGTCAGAAATTCTGTAATATTACCTTCAGGTAACTCCTCTCACTCTATAACATCGCCAACAAGTGTAGCCTCACCACAATGCGCTACTAGTCCTATAACAACGTCAACTATATCCACTGACAGCACCCAGCCGCTGACCGGCGTGGCAACTTCGTCCGCGACCCCACAGTCTCCTAGCGCACATTACATACTCGCACCATCGAACAGGAGTATAACAACGGCCGCTGTTACTAAGAAAGGTAATGGCTTGCAATCACCCTTGGCAACGCACGTATAA
Protein
MSNYRPRTTSRDVKPLFLLLRTKYVRFYVFSAIFISSFSVCCGFAEQKFAMEPQDQTAVIGSRVTLPCRVENKVGQLQWTKDDFGLGLHRELSGYDRYKMIGSDEEGDYSLDIRDVNLDDDAKYQCQVSSGVKGEPAIRSRYARLTVLVPPEPPKILQGNFYSTTEDRNIKLECVSVGGKPPAEITWVDSNAGVLTQGVTYTVEPLSDGQRFTARSIINMTPKKEHHNQTFICQAQNTADRAYRAASIQIEVKYAPKVKIYIKSRVNGRIPEGDDVTIGCKADANPTNLTYKWYINEESINGNTTELKIYNISRKYHDAIVKCVVYNDVGKTEEEETLEITYAPSFRHLPKDVEAEVGTSVTLSCDVDSYPNPEIRWLHHEEDQTIRVGRTPNLTLTVDTHTSGRYLCKASVDGFPEIEAEASVFIKGPPKIISNQTQFGTQGDTVNIECAAFAVPRIDSIIWTFNGREIDSLHDQDYAFLEDLQSGGIVNSTLIIRESQYKHFGVYKCNVSNDYGNDYLEITVTAKEALPLLVIIFSVTTCTIAVVCLTMLIIICQRKQKRGKQSQVAEKPDVTVTAQELFKDNDRNSNISDLKLELRQANGSCEIDYSNTGSDSTLCSNAKLGSGIPLAGSVPLASMNQNNYQPYRYSNDYTDPAYADCYKVNGFNNGYQTYVHYGHDYTPGSLRVQSPTLASDKLTPNRSINGSLPRSVDTPSTVQYNVGNGSQNNSLQRSTKRQDSSSALNNLGLPTAEVSRVPNGGIHGVDIRYAATYGNPHLRSGGGLGFNTVNTAKPASTPAPPPYSSVRNSVILPSGNSSHSITSPTSVASPQCATSPITTSTISTDSTQPLTGVATSSATPQSPSAHYILAPSNRSITTAAVTKKGNGLQSPLATHV

Summary

EMBL
KZ149957    PZC76453.1    NWSH01000121    PCG79332.1    AGBW02010002    OWR49362.1    + More
KQ458859    KPJ04830.1    ODYU01003674    SOQ42744.1    NWSH01003040    PCG67071.1    PCG67070.1    PCG67069.1    KPJ04832.1    KQ460254    KPJ16354.1    PZC76455.1    AGBW02010884    OWR47582.1    NWSH01000084    PCG79784.1    KQ971321    EFA00099.1    KYB28679.1    KYB28680.1    AGBW02014999    OWR40735.1    GEZM01036660    GEZM01036657    GEZM01036656    JAV82535.1    GEZM01036659    GEZM01036658    GEZM01036655    JAV82537.1    GEDC01030411    GEDC01029028    GEDC01027080    GEDC01026323    GEDC01026079    GEDC01021839    GEDC01021418    GEDC01008721    GEDC01004895    JAS06887.1    JAS08270.1    JAS10218.1    JAS10975.1    JAS11219.1    JAS15459.1    JAS15880.1    JAS28577.1    JAS32403.1    GEDC01024142    GEDC01013685    GEDC01006693    JAS13156.1    JAS23613.1    JAS30605.1    RSAL01000064    RVE49474.1    APGK01018010    APGK01018011    APGK01018012    APGK01018013    APGK01018014    APGK01018015    KB740064    ENN81761.1    KB632165    ERL89278.1    KZ150124    PZC73139.1    GFTR01007564    JAW08862.1    GBHO01024576    GBRD01006502    JAG19028.1    JAG59319.1    JXUM01018125    KQ560503    KXJ82106.1    UFQT01000015    SSX17766.1    CH477251    EAT46033.1    ATLV01013099    KE524840    KFB37203.1    AAAB01008846    EAA06357.5    CH964239    EDW81949.1    DS232044    EDS32996.1    GEBQ01005564    JAT34413.1    GBXI01005154    JAD09138.1    JXUM01051192    JXUM01051193    JXUM01051194    JXUM01051195    KQ561678    KXJ77827.1    CVRI01000013    CRK89578.1    GEBQ01016034    JAT23943.1    AXCN02002018    AXCN02002013    GAMC01011307    GAMC01011306    GAMC01011305    JAB95248.1    OUUW01000015    SPP88532.1    CH379064    EAL31716.3    KRT06480.1    JXUM01063713    KQ562264    KXJ76278.1    CCAG010019211    JXJN01009949    GDHF01015366    JAI36948.1    APCN01001155    AF196553    AJ289882    AAF86308.1    CAB96574.2    AE014298    AAF45847.2    AAN09598.1    AFH07219.1    AFH07220.1    AFH07221.1    AFH07222.1    AGB95042.1    AJWK01023927    APCN01001193    AXCM01000695   
Pfam
PF08205   C2-set_2        + More
PF07679   I-set
PF07686   V-set
PF13895   Ig_2
Interpro
IPR003598   Ig_sub2        + More
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013162   CD80_C2-set       
IPR013783   Ig-like_fold       
IPR013106   Ig_V-set       
SUPFAM
SSF48726   SSF48726       
Gene 3D
PDB
4OF8     E-value=1.0144e-84,     Score=802

Ontologies

Topology

Length:
896
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
42.5674800000002
Exp number, first 60 AAs:
19.56903
Total prob of N-in:
0.87598
POSSIBLE N-term signal
sequence
inside
1  -  23
TMhelix
24  -  46
outside
47  -  532
TMhelix
533  -  555
inside
556  -  896
 
 

Population Genetic Test Statistics

Pi
240.588641
Theta
172.340197
Tajima's D
1.197832
CLR
0.139761
CSRT
0.71986400679966
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号