SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14357
Annotation
unnamed_protein_product_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.286
 

Sequence

CDS
ATGGTAGACCAGTCAACGATCCCCTTAGCTGATCAAAGATACCATACACCAGCTCCAATTGATCTGTTGTTAGGCTCGGATATCCTCGGACAGGTTTTAGATGGGACTAAAGTCTCGTTGGGGCCCGGCAGGCCAATAGCCTTCGGCACGATATTTGATTTTACATTGTTAGGACCCATACACGATTTGTATACTGCTCCTGTAAGCAAAACTGAATCGGCTCACATTGTCAGCGCACAACCAGAACTCGAGGTATCTACACATGACATTCGCAAGAGCCTTGAGAAGTTCTGGGAATCTGAAGAGCCCCAACTTCATGTTGAAACTACCCCTTTGCAAGATCAGTGTGAAGAAATATTCCGCACTACCACTACTCGTAAACCCTCAGGTCAATATACGGTAACTTTACCCTTTTTACATAATATGCCCGAGCTAGGAAGTACCCATGCCATAGCATTGCGTAGGTTTCTTAATCTTGAAAAGAAGTTACAAGCTGACCCATATCTCCGTGTGAAATACATTGACTTCATGGCAGATTATCAGAAGCTGGGTCACATGTCCCCATGCCACCCGAGTACTTTTGCTCATAAGCCTCACTTCTATATCCCTCATCATGGCATCTTCAAGTCGGGATCAGACAAGCTACGCACTGTTTTTGATGGTAGCTGTAAAAGCTCAAATGGCGTCAGCCTAAATGACTGTTTACACACTGGTCCAGCTCTTCAACAGGACATCGTCGATATTATCTTGTCGTTTAGAACTCATCCTGTAGTTTTCAGCACTGACATTTGTATGATGTTCAGAAACATACTCATACATCCCGATCAGAGGCGTTACCAGCTCATTCTCTGGCGCTCTTCGCCAGATCAGCCCCTGCTTACATATGCCTTAAACACTGTTACATACGGGTTAAGATCAAGCCCATATCATGCTATACGCACTTTAATCCAATTAGCGGATGATGAAGGTCATCGCTATCCTGCAGCTGCTCAAGTGCTGCGCAAGTCCATATTCGTCGATGATATTCTCACTGGTCACGATTCTGTAGTAAAGGCTCAAGCTCTCCAAAACGACTTGATTAACTTACTAGCCTTAGGTGGTTTTCAGCTCAGTAAATGGACCTCAAACTGCCCTCAGCTTCTCGAAAGATTTCCCGATGATCAGTGTGACATGCCCAAGAACTTTGTCATTAGCCCAGACTCCAACTCCATAAAAGTATTAGACAGTACCATTGTCCTAGCATGGCTAAACACACCTCCTCATAGACTTCAGGTCTTTGAAGCCAACAGGGTTGCCAAGATAACATCCAATCCAATCACCTCCACATGGAAACATGTTCCTACAAACCTGAACCCTGCAGACTGTGCGAGCAGGGGAATGTCTGCCCAGTCACTATCAGCTCATGATCTTTGGTGGTCTCCTAGCTGGCTGAAGGAGCCTCCTGACACCTGGCCCAAAATGCCTCCTGCTCTAGGCCACCATGCGCTACCAGGTCTGAAGCCCAAGAAAGTACCAGCTCATATAGCAGTTCCTGACCTCGACCTTGACTTGCTTACTCGATTCAGTTCTCTCGACAAGCTCGTTGGAGTGACAGCTTGCATAAAACGCTTTATTTTCAATTGTAGACACAACTCAACTGATAGGTGCTCTGGTCCCTTGACAGTTGGAGAACGTAGAGATGCTCTGTTATTCTGGGTTCGCTCTGTTCAACACAATGAGTTTGCGGAAGATATTTACCGTCTTCAGGCAGGCAAGATTTGTACCGTTCGACTTCAGCGTCTTTCACCCTTGATGAAAGATGATCTCTTGAGAGTTGGTGGTCGCCTCACTCATGCGCCAATAAGATACGATGCTCAGCATCCTCTCGTTCTGCCCAGCTCTAGCCCACTAGTTGATCTCATCATAGACCACTATCACAGAATAAACTGTCATCCTGGGGCTGACACATTACACGCTATCCTCCGTCAGCAGTTCTGGATACTCTCAGCACGTCGTGTCATCAGGCATCGCGTGTACAAATGCATTAGATGTTTCCGATATCGCGCTCAGGCCAGAGCTCCGTTGATGGCTGATTTGCCCGCAGACAGGGTCACACCTCAGCCACTCATCCAAGCTCTCTCTCAGCGTTTTTGGACTCTGTGGACCAAATCCTATCTCCATACCCTCCAAACCCGCTCCAAATGGCTTTCCACATCCTCACCTCCTCAAGTTGGAGAGCTCGTCCTCATCAAAGAGGACAATCAGCCCCCGCTGCAATGGAAACTTGGAAGGATTATCCGCACGTTACCCGGCAAGGATGGAGTGATCAGAGTCGTGGATTTGGATACGAAGCATGGAAGTCTGCGGAGACCTGTGTTCAAATTCGATACAAGAGAAGGAGTGACTTCGCATTGGTCGGATCCTACCACCTTAGGAGTGAGAGCAACCTTCAGAAGCAACTCTCGTCCAGCAGTCCTTATTCTTAGTAAATTAAGACCAGAAGACAGCGGTCAATATAGATGCAGAGTGGACTTCATTAAATCACCAACGAAAAATACAAGACTAAACCTAACTGTTCTAATTCCACCAGAGCGACTTATAGTTCTGAACCATGAAGGGAACGAGGTAAACGGAGGAGTTGTCGGACCTTATGACGAGGGAACAGAGGTCAATCTCACTTGTATAGCCGTTGGAGGTCGACCGATTGCACGAGTCTCGTGGTGGAAAGCGCACGCACTCCTCGCGAACTCCGAAGCGAGAGCTACTGTCTCCTTCAGGGTTCAAAGGTCGGACTACGGCACCGACGTCATGTGTCAGGCAGTAACTGATCCCCTAATATCACCCGTCTCGGAGAATATATCAATAGACGTGAATCACGAGCATACGGCCCCACCTGATGGTGAGTGGTTACCGTCGCCCATGGACTTCAGCAATGCCAGGGGCAGAGCCAAGCCGAGGCCTACCGCTTAA
Protein
MVDQSTIPLADQRYHTPAPIDLLLGSDILGQVLDGTKVSLGPGRPIAFGTIFDFTLLGPIHDLYTAPVSKTESAHIVSAQPELEVSTHDIRKSLEKFWESEEPQLHVETTPLQDQCEEIFRTTTTRKPSGQYTVTLPFLHNMPELGSTHAIALRRFLNLEKKLQADPYLRVKYIDFMADYQKLGHMSPCHPSTFAHKPHFYIPHHGIFKSGSDKLRTVFDGSCKSSNGVSLNDCLHTGPALQQDIVDIILSFRTHPVVFSTDICMMFRNILIHPDQRRYQLILWRSSPDQPLLTYALNTVTYGLRSSPYHAIRTLIQLADDEGHRYPAAAQVLRKSIFVDDILTGHDSVVKAQALQNDLINLLALGGFQLSKWTSNCPQLLERFPDDQCDMPKNFVISPDSNSIKVLDSTIVLAWLNTPPHRLQVFEANRVAKITSNPITSTWKHVPTNLNPADCASRGMSAQSLSAHDLWWSPSWLKEPPDTWPKMPPALGHHALPGLKPKKVPAHIAVPDLDLDLLTRFSSLDKLVGVTACIKRFIFNCRHNSTDRCSGPLTVGERRDALLFWVRSVQHNEFAEDIYRLQAGKICTVRLQRLSPLMKDDLLRVGGRLTHAPIRYDAQHPLVLPSSSPLVDLIIDHYHRINCHPGADTLHAILRQQFWILSARRVIRHRVYKCIRCFRYRAQARAPLMADLPADRVTPQPLIQALSQRFWTLWTKSYLHTLQTRSKWLSTSSPPQVGELVLIKEDNQPPLQWKLGRIIRTLPGKDGVIRVVDLDTKHGSLRRPVFKFDTREGVTSHWSDPTTLGVRATFRSNSRPAVLILSKLRPEDSGQYRCRVDFIKSPTKNTRLNLTVLIPPERLIVLNHEGNEVNGGVVGPYDEGTEVNLTCIAVGGRPIARVSWWKAHALLANSEARATVSFRVQRSDYGTDVMCQAVTDPLISPVSENISIDVNHEHTAPPDGEWLPSPMDFSNARGRAKPRPTA

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF18701   DUF5641
PF05380   Peptidase_A17
Interpro
IPR012337   RNaseH-like_sf        + More
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D
ProteinModelPortal
PDB
5ZO2     E-value=9.66964e-06,     Score=121

Ontologies

Topology

Length:
982
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01251
Exp number, first 60 AAs:
0.0078
Total prob of N-in:
0.00058
outside
1  -  982
 
 

Population Genetic Test Statistics

Pi
187.009019
Theta
158.449151
Tajima's D
1.025032
CLR
0.115284
CSRT
0.669016549172541
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号