SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14342
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.063
 

Sequence

CDS
ATGAAAGTCGACAAAAGAAAAAGAGTTTTTTCGGCGGATCCCCATTCCACGTTTAATGTGGATTTCAGCAATGTCAGGGGCCTACACAGTAACCTTGACGCCGTACATCACCACCTTGAGACGGCGCAGCCTGCCCTCTTTTTCCTGACTGAGACGCAGATATCTGCCCCGGACGATACGTCGTACCTCGGATACCCCGGCTACGCATTGGAGCACACCTTCCTGCGTAAAGCCGGGGTGTGCGTGTTTATCCGGGAGGATGTCTGCTGTCGTCGGCTTCGGGGCCTCGAGCAACGGGACCTGTCCCTCTTGTGGCTACGCGTGGACTATGGGGGCTGTACCAGAGTCTACGCTTGCCTGTACAGGTCTCACAGCAGTGATGCGGGGTCAGCTCTGTTTGAGCATGTACAAGAGGGGACTGACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTCCTTGGTGACTTTAACGCTCATCACCAGGAGTGGTTGGGTTCCAGAACCACTGACCTCCCGGGTCGGGCTGCCTACGATTTCGCCTTGTCCTACGGCCTCTCACAACTGGTGACACAGCCCACCCGTGTCCCAGACATTGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACTCACCCAGCTGGATACAGTGTGGTGGTCGACGCTCCACTTGGATCGTCTGATCACTGCCTTATCCGTGCTGCCATACCACTCTCTCGTCCTAGTCGTCGAACGACGACCGGGTTTCGAAGAGTTTGGCGGTACAGGTCAGCAGACTGGGATGGAATGCGTGAATTTTACGCATCCTACCCATGGGGGCGGCTCTGCTTTTCCTCCGATGATCCTGACGTCTGTGCGGACCGACTTAAAGACGTGGTGCTTCAGGGAATGGAATTATTCATTCCTTCTTCTGAGGTGCCCGTTGGGGGTCGCAGCAAACCCTGGTATAATAAAGCCAGTAGGGATGCTGCACGCCTCAAGCGGTCTGCATACGTGGCATTTAATGTTGCTAGGAGATGCCGGGATCCTGATATCTCGGAGAAAAGGCGGAAATTTAACGCCGCCTCTAGGTCCTATAAGAGGGCTATTGCCAAGGCGAAGTCGGAGCACGTTGCCAGAATTGGCGAGCGACTGAATAGCTATCCCTCTGGGAGCCGTGCTTTCTGGTCGCTAGCTAAGGCTGCAGAAGGTAACTTCTGCAGGTCTAGCCTTCCACCACTGCGTAAGTCCAATGACAGTCTGGCTCATAGTGCGAAGGAGAAGGCTGACCTTCTGGTCAAGCTCTTTGCCTCATACTCGACTTTGGATGACGGAGGAGCCACGCCGCCCAACATCTCCCGGTGTGACAGCTCCATGCCTGAGATTCGCATCACACAGCGTGCGGTCAGGCAGGAGCTTCGGCTTCTTGATGTCCATAAGTCGAGTGGGCCAGATTGCATCCCCGCAGTGGTTCTAAAAACATGCGCCCCTGAATTGACACCCGCGCTAACGCGTCTATATCGCCTCTCGTACAATACCAACAGGGTTCCGTCTTCATGGAAGACTGCTCATGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCCTCGAATTACAGACCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATCATAAACATCCAACTTCTTAAGTATCTTGAGGATCGCCAGCTGATCAGTGACCGGCAGTACGGTTTCCGTCATGGGCGCTCAGCTGGCGATCTTCTTGTATACCTCACACATAAATGGGCTGAAGCCTTGGAAAGCAAGAGCGAGGCTCTCGCTGTGAGCCTTGACATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGCTTCCAGCATACGGGATCCCTGAGGGACTCTGCAAGTGGATCGCTAGCTTTTTGGATGGACGGAGCATCGCAGTTGTCGTCGACGGCTGCTGCTCCGATACCATGACCATCAACGCTGGTGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATACTGCATATCAATGACATGCTATCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGAAACGTTGTACACGAGAGGCGATTAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGGGTCTCCAAGTGGGGTGAACTGAATTCAGTTCAGTTCAACCCATTGAAGACACAGGTTTGCGCGTTCACTGCGAAGAAGGACCCTTTTGTCATGGCGCCGGAATTTCAAGGAGTATCCCTGCAGCTTTCCGCGAGTATCGGGATTCTGGGGGTCGATATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGTAAAGCCAAATTGGCCTCTAAAATGTTGGGAGTTCTCAACAGAGCGAAGCGGTATTTCACGCCTGGACAGAGACTTGCGCTTTATAAAGCGCAGGTCCGACCTCGCGTGGAGTACTGCTCTCACCTCTGGGCCGGGGCTCCCAAATACCAGCTACTTCCATTTGACTCCATACAGAAACGGGCTGTTCGGATGGTCGATAGTCCTGCTCTCGCGGATCGCTTGGAACCTCTGGGTCTACGGAGGGACTTCGGTTCTCTCTGTGTTTTATATCGCATGGTCCATGGGGAATGCTCTGAGGAATTATTCGAGATGATTCCCTCATCTCCTTTTTATCATCGCACCTCCCGCCATCGGAGCAGAGTTCATCCATATTATCTGGAACCGCTGCGTTCATCGACAGTGCGTTTCCAAAGATCTTTTTTGCCACGTACCATCCGGCTTTGGAATGAACTCCCCTCCACGGTGTTTTCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGCGGAGAGTTCTTTATGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGACGTCCATGAGCGACGGTGA
Protein
MKVDKRKRVFSADPHSTFNVDFSNVRGLHSNLDAVHHHLETAQPALFFLTETQISAPDDTSYLGYPGYALEHTFLRKAGVCVFIREDVCCRRLRGLEQRDLSLLWLRVDYGGCTRVYACLYRSHSSDAGSALFEHVQEGTDRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRAAYDFALSYGLSQLVTQPTRVPDIEGHEPSLLDLLLTTHPAGYSVVVDAPLGSSDHCLIRAAIPLSRPSRRTTTGFRRVWRYRSADWDGMREFYASYPWGRLCFSSDDPDVCADRLKDVVLQGMELFIPSSEVPVGGRSKPWYNKASRDAARLKRSAYVAFNVARRCRDPDISEKRRKFNAASRSYKRAIAKAKSEHVARIGERLNSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSNDSLAHSAKEKADLLVKLFASYSTLDDGGATPPNISRCDSSMPEIRITQRAVRQELRLLDVHKSSGPDCIPAVVLKTCAPELTPALTRLYRLSYNTNRVPSSWKTAHVHPIPKKGDRSDPSNYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHKWAEALESKSEALAVSLDIAKAFDRVWHRALLSKLPAYGIPEGLCKWIASFLDGRSIAVVVDGCCSDTMTINAGVPQGSVLSPTLFILHINDMLSIDGMHCYADDSTGDARYIGHQSLSRNVVHERRLKLVSEVENSLGRVSKWGELNSVQFNPLKTQVCAFTAKKDPFVMAPEFQGVSLQLSASIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLALYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQKRAVRMVDSPALADRLEPLGLRRDFGSLCVLYRMVHGECSEELFEMIPSSPFYHRTSRHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFSERYDMSFFKRGLRRVLYGRQRLGSAPGIADVHERR

Summary

EMBL
AY359886    AAQ57129.1    RSAL01000041    RVE50934.1    RSAL01000422    RVE41792.1    + More
RSAL01000090    RVE48098.1    DPOC01000269    HCX22453.1    HAAD01000593    CDG66825.1    GDRN01111334    JAI56796.1    GDRN01111277    JAI56804.1    GDRN01111278    JAI56803.1    NSIT01000225    PJE78229.1    AH011247    AAL40415.1    NSIT01000234    PJE78200.1    AAGJ04060226    NSIT01000271    PJE78081.1    GDRN01111326    JAI56798.1    AAGJ04103823    NSIT01000164    PJE78524.1    AAGJ04112043    NSIT01000300    PJE77993.1    NSIT01000412    PJE77717.1    GFAA01002675    JAU00760.1    GEGO01003274    JAR92130.1    LWDP01000127    ORD93263.1    AAGJ04029969    LSMT01000899    PFX13773.1    GEGO01004441    JAR90963.1    DNUT01000434    HBI40906.1    AAGJ04110620    NSIT01000294    PJE78013.1    LSMT01000907    PFX13730.1    NEDP02004020    OWF47171.1    GEGO01001118    JAR94286.1    GFAA01002465    JAU00970.1    GEGO01003370    JAR92034.1    AGCU01114349    GEGO01003794    JAR91610.1    LSMT01000769    PFX14518.1    GEGO01004630    JAR90774.1    GEGO01003111    JAR92293.1    LSMT01000412    PFX18406.1    GEGO01003594    JAR91810.1    AGCU01024294    GEGO01004132    JAR91272.1    AGCU01196469    LSMT01000295    PFX21010.1    AGCU01054950    AGCU01146099    AGCU01131815    AGCU01196302    AGCU01106033    AGCU01205039    AGCU01018346    AGCU01004663    AAGJ04114595    GEGO01003776    JAR91628.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00002   7tm_2
PF01585   G-patch
PF04939   RRS1
PF02460   Patched
PF03372   Exo_endo_phos
PF00096   zf-C2H2
PF12017   Tnp_P_element
PF00350   Dynamin_N
PF07714   Pkinase_Tyr
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000832   GPCR_2_secretin-like       
IPR017981   GPCR_2-like       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR034653   SPF45_RRM       
IPR003954   RRM_dom_euk       
IPR000467   G_patch_dom       
IPR040052   RBM17       
IPR035979   RBD_domain_sf       
IPR007023   Ribosom_reg       
IPR030223   Dispatched       
IPR003392   Ptc/Disp       
IPR000731   SSD       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR019787   Znf_PHD-finger       
IPR021896   Transposase_37       
IPR022812   Dynamin_SF       
IPR008266   Tyr_kinase_AS       
IPR000719   Prot_kinase_dom       
IPR011009   Kinase-like_dom_sf       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR027417   P-loop_NTPase       
SUPFAM
SSF56219   SSF56219        + More
SSF54928   SSF54928       
SSF57903   SSF57903       
SSF57667   SSF57667       
SSF52540   SSF52540       
SSF56112   SSF56112       
Gene 3D
PDB
6AR3     E-value=0.0310085,     Score=91

Ontologies

Topology

Length:
986
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00798999999999998
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00034
outside
1  -  986
 
 

Population Genetic Test Statistics

Pi
201.960141
Theta
28.91955
Tajima's D
3.668757
CLR
0.004061
CSRT
0.996800159992
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号