SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14332
Annotation
PREDICTED:_uncharacterized_protein_LOC106137322_[Amyelois_transitella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 3.25
 

Sequence

CDS
ATGGAAGGAGATTCACTCAGAGCTTTCAAGGATTGCAAGAAAAGCCTTGCAGATGCAGCATTGCTGGCTCATCCTGACCCTCAAGCCAAATTAGGTCTAGTTACGGACGCCTCCGATACCGCAATAGGTGGAGTACTTCAGCAGCTCAAAGAGGAAGGTTGGCAGCCATTAGGTTTCTTCTCCCGCAAGCTGAGCCCGTCACAAATGAAATACTCTCCGTACGACCGTGAGCTCCTTGCGATTTACGAGAGCATACGCTACTTTCGGCACATGCTGGAAGCCACCCACTTCACAGTCTACACTGACCACAAGCCGCTATGTTACGCTTTCCACCAGCGGAAAAGTAATTGTTCACCACGTCAGTATAGACACCTCGACTTCATCTCGCAGTTCACCTCGGACATCGTCCACATCGCCGGTAAAGATAACGTGGTGGCGGATACCCTATCGCGCGTTGATGAACTGCAGACGCCTGTCGACCTAGAAGTGATGGCCAATCTACAAGCCTCAGATGCTGAACTCCAAGACCACCTAACAGGCGAGACTTCTCTTCGCCTAGTCCAGACGAGCATACCTGGGAGTCGAGCCATTTTGTACTGCGACATCAGCACACCGACACCCAGACCCTTCGTCCCACATCAACTGCGCCAGCAAGTTTTTGACTGCCTCCACTCGCTCAGTCATCCAGGTCCCAATGCGACAACTAAACTAAATTCCGACCCGGATCCAAAACCAGATCCAGGGCCTCCACACCAGCAGACGACTCGATCGGGGAGGAAAGTACGCTTTCCCGATTATTATCGACCTAAGTAG
Protein
MEGDSLRAFKDCKKSLADAALLAHPDPQAKLGLVTDASDTAIGGVLQQLKEEGWQPLGFFSRKLSPSQMKYSPYDRELLAIYESIRYFRHMLEATHFTVYTDHKPLCYAFHQRKSNCSPRQYRHLDFISQFTSDIVHIAGKDNVVADTLSRVDELQTPVDLEVMANLQASDAELQDHLTGETSLRLVQTSIPGSRAILYCDISTPTPRPFVPHQLRQQVFDCLHSLSHPGPNATTKLNSDPDPKPDPGPPHQQTTRSGRKVRFPDYYRPK

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
RSAL01000969    RVE41014.1    LBMM01008151    KMQ89105.1    LBMM01011855    KMQ86587.1    + More
GEDC01031421    JAS05877.1    LBMM01013040    KMQ85849.1    LBMM01012479    KMQ86204.1    LBMM01012030    KMQ86466.1    LBMM01013103    KMQ85815.1    GECZ01025246    JAS44523.1    GAKP01002499    JAC56453.1    LBMM01006500    KMQ90563.1    IAAA01053083    LAA11740.1    GFXV01006394    MBW18199.1    GEZM01017686    JAV90495.1    LBMM01009142    KMQ88359.1    GECZ01031884    JAS37885.1    KL363355    KFD46748.1    GDHF01025092    JAI27222.1    GDHF01031831    GDHF01029767    GDHF01007852    GDHF01005646    JAI20483.1    JAI22547.1    JAI44462.1    JAI46668.1    GGMR01003899    MBY16518.1    KL367492    KFD69854.1    KL367564    KFD63933.1    KL367655    KFD60653.1    IAAA01033850    LAA08869.1    GEZM01030221    GEZM01030220    JAV85666.1    GDHF01025941    GDHF01018068    GDHF01016902    JAI26373.1    JAI34246.1    JAI35412.1    GBXI01017046    JAC97245.1    GEZM01030219    GEZM01030216    JAV85668.1    GBHO01029676    JAG13928.1    GAKP01013651    JAC45301.1    MRZV01000532    PIK48264.1    KL367555    KFD64489.1    GEZM01003178    JAV96889.1    GAMC01010904    JAB95651.1    GEZM01036621    JAV82565.1    AAGJ04172791    GAKP01020774    GAKP01020771    GAKP01020770    GAKP01020769    JAC38178.1    GBYB01009311    JAG79078.1    KL367594    KFD62480.1    GBXI01015889    JAC98402.1    GDQN01005646    JAT85408.1    GEGO01004475    JAR90929.1    KL363241    KFD51254.1    KL367552    KFD64647.1    LN877232    CTR11708.1    MRZV01000184    PIK56201.1    KQ973093    EFA13472.2    LBMM01002985    KMQ94111.1    MRZV01000446    PIK49797.1    QPMK01000061    RDD63998.1    KL251028    KGB38486.1    MRZV01000203    PIK55727.1    BN000802    CAJ00250.1    IAAA01038888    LAA08744.1    KQ971355    EFA07205.2    CABG01000001    CCD58591.1    MRZV01002078    PIK34788.1    GEGO01003687    JAR91717.1    MRZV01001127    MRZV01000556    PIK40396.1    PIK47817.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GBXI01003773    JAD10519.1    LBMM01001181    KMQ96765.1    MRZV01000001    PIK63042.1    LBMM01012923    KMQ85927.1    LBMM01012134    KMQ86388.1    ABLF02050624    GAKP01011967    JAC46985.1    KL367519    KFD66948.1    HE601625    CCD77521.1    IAAA01040175    LAA10459.1    AAGJ04112098    GGMR01010038    MBY22657.1    LBMM01012917    KMQ85929.1    AAGJ04130731    LBMM01012567    KMQ86146.1    AAGJ04032598    FN356212    CAX83701.1    GGFK01003401    MBW36722.1    GGFK01003442    MBW36763.1    AB032722    BAA92694.1    AB032721    BAA92693.1    EF426679    ABP48077.1    GGLE01001814    MBY05940.1    BK004070    DAA04500.1    GFDL01003994    JAV31051.1    GAKP01008886    JAC50066.1    QCYY01002214    ROT72055.1    MRZV01001036    PIK41257.1    MRZV01000068    PIK59982.1    CM012448    RVE65529.1    BK004066    DAA04495.1    LBMM01012451    KMQ86215.1    GDHF01014424    JAI37890.1   
Pfam
PF17917   RT_RNaseH        + More
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF01087   GalP_UDP_transf
Interpro
IPR041373   RT_RNaseH        + More
IPR041588   Integrase_H2C2       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR013032   EGF-like_CS       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF54197   SSF54197       
SSF56219   SSF56219       
PDB
4OL8     E-value=4.53969e-13,     Score=179

Ontologies

Topology

Length:
270
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00022
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03148
outside
1  -  270
 
 

Population Genetic Test Statistics

Pi
362.464587
Theta
148.014805
Tajima's D
4.095129
CLR
0
CSRT
0.9990000499975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号