SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14320
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.125
 

Sequence

CDS
ATGTACCGCTTTCCGGTCGAGCGCGGTGTTCCACAGGGGTCTGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCTTGCGGGGCGTCGTACGGGGTCCCCTCCCCGGGCTGAGCGTAATATGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACAAGGATCCGACGGCTGGGACTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTGTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTTGAACTGGATGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGACTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCAGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACAGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVVRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPSEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

EMBL
AB090825    BAC57926.1    KZ150386    PZC71062.1    AB078930    BAC06454.1    + More
AB078931    BAC06456.1    AB078935    BAC06462.1    AB078929    BAC06452.1    RSAL01000481    RVE41577.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    LBMM01024063    KMQ82623.1    LBMM01019839    KMQ83438.1    LBMM01006954    KMQ90166.1    LBMM01019838    KMQ83439.1    LBMM01006671    KMQ90407.1    LBMM01006725    KMQ90373.1    LBMM01008861    KMQ88580.1    LBMM01004272    KMQ92618.1    LBMM01006063    KMQ90967.1    LBMM01007036    KMQ90099.1    LBMM01014132    KMQ85305.1    LBMM01006657    KMQ90417.1    LBMM01009738    KMQ87908.1    LBMM01008448    KMQ88867.1    RSAL01003504    RVE40273.1    LBMM01005733    KMQ91252.1    LBMM01015018    KMQ84954.1    LBMM01004505    KMQ92346.1    LBMM01015025    KMQ84953.1    LBMM01008682    KMQ88705.1    LBMM01003245    KMQ93755.1    LBMM01007425    KMQ89740.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01003988    KMQ92922.1    LBMM01004697    KMQ92167.1    LBMM01002480    KMQ94776.1    QOIP01000031    RLU14697.1    QOIP01000010    RLU18098.1    LBMM01005948    KMQ91066.1    LBMM01014956    KMQ84982.1    LBMM01005216    KMQ91703.1    LBMM01006496    KMQ90570.1    GL450953    EFN80213.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01007659    KMQ89538.1    LBMM01021647    KMQ83033.1    KMQ94772.1    LBMM01014122    KMQ85315.1    LBMM01008422    KMQ88894.1    LBMM01005474    KMQ91485.1    LBMM01005465    KMQ91492.1    GGMR01000779    MBY13398.1    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    GECU01032129    JAS75577.1    KQ971864    EFA13315.2    LBMM01008349    KMQ88951.1    ABLF02011238    GGMR01015159    MBY27778.1    GGMR01014195    MBY26814.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02041886    LBMM01012595    KMQ86127.1    ABLF02014530    ABLF02018586    ABLF02058000    GFXV01003903    MBW15708.1    KQ971309    EEZ99146.1    KU543683    AMS38371.1    LBMM01006662    KMQ90413.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GALX01004785    JAB63681.1    ABLF02014378    GGMS01012210    MBY81413.1    GFXV01002242    MBW14047.1    GGMR01004600    MBY17219.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGMR01015354    MBY27973.1    ABLF02006132   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
4XVM     E-value=0.0339239,     Score=87

Ontologies

Topology

Length:
437
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.42271
Exp number, first 60 AAs:
0.07207
Total prob of N-in:
0.01392
outside
1  -  437
 
 

Population Genetic Test Statistics

Pi
36.578713
Theta
28.900322
Tajima's D
1.045475
CLR
0.048625
CSRT
0.67751612419379
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号