SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14308
Annotation
endonuclease-reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 3.482
 

Sequence

CDS
ATGGAAGAAATTTTGATTGCGCTCAAAGAAATAAAGAAAGACCTGGACGAGCAGAGACAAGAAATCCGAGCAACTGGAATTAATGTTACGGATAAAGTATCAAAAAATGTAAACAAAATGCTCGAAGAAAAATTCCTAGTATGGGAAAAAAAGTATGAAAACTTGAAAAAAATAACGGAAAACCAAGAAAAGAGAATCTATTTTCTAGAAAAAGAGGTAAGAAAAAGAAATATAGTATTTTTTGGCATCGAAGAGTCAGAAAAATCGTATGAAAATCTAGAAAATACTATTATTAATTGGATAAGCCAATATCTTAATATTCAGCTAAAGCACTGCGACATACAAGAAGTCAGGAGAGTGGGAAAGAAAGAGGAACGACCACGCCCTATAGTAGTGACCTTCACAACACTAGGTACTAAAATTAAAAGCTGGAAACGAAGAAATACACTAAAAGATACCTATTTCTACATGAAAGAAGATTACCCGAAGTACGTGCTAGAAAAGAGGAAGGGCTTACAAGAGCAGCTACGTATAGAAAGAGAGAAGGGAAATACAGCGTTATTGAAGTATGATAAATTGATCATCCTGCCCAAAACCAATACGAAAAGAAAATTACCCACCTCACCAAACAGCGGCACAACTTCAAAAGTAAACGAGACCTCACAAATAAACAAGAAGAACAAGATTCAAAAACCTGGTACCCCCGTGATAAGATCCAACAGCATCTCCGAGGGAGTTGTTAAACCAGGCATGCTGAACTTCTTGGTGAATAAAAACACCATAACGGCTAGTAATCATAACCCAGGAAAATCAACATAG
Protein
MEEILIALKEIKKDLDEQRQEIRATGINVTDKVSKNVNKMLEEKFLVWEKKYENLKKITENQEKRIYFLEKEVRKRNIVFFGIEESEKSYENLENTIINWISQYLNIQLKHCDIQEVRRVGKKEERPRPIVVTFTTLGTKIKSWKRRNTLKDTYFYMKEDYPKYVLEKRKGLQEQLRIEREKGNTALLKYDKLIILPKTNTKRKLPTSPNSGTTSKVNETSQINKKNKIQKPGTPVIRSNSISEGVVKPGMLNFLVNKNTITASNHNPGKST

Summary

EMBL
NWSH01000023    PCG80652.1    KQ459995    KPJ18566.1    JTDY01008567    KOB64512.1    + More
JTDY01009375    KOB63594.1    ODYU01008249    SOQ51673.1    FJ265563    ADI61831.1    JTDY01002701    KOB70892.1    JTDY01000780    JTDY01000104    JTDY01000008    KOB75906.1    KOB78842.1    KOB79479.1    NWSH01002039    PCG69337.1    JTDY01014369    KOB52037.1    JTDY01010650    KOB58126.1    JTDY01007191    KOB65392.1    JTDY01009161    KOB64038.1    JTDY01000076    KOB79001.1    JTDY01000843    KOB75692.1    JTDY01000640    KOB76373.1    JTDY01000895    KOB75518.1    ODYU01010663    SOQ55918.1    JTDY01000100    KOB78869.1    JTDY01001015    KOB75121.1    FJ265562    ADI61830.1    JTDY01016948    KOB51874.1    JTDY01010526    KOB58179.1    JTDY01000977    KOB75230.1    JTDY01000437    KOB77173.1    NWSH01001771    PCG70189.1    JTDY01001575    KOB73484.1    NWSH01000260    PCG77926.1    GBGD01002698    JAC86191.1    NWSH01003397    PCG66369.1    KZ150150    PZC72845.1    NWSH01004020    PCG65566.1    NWSH01005231    PCG64345.1    FJ265564    ADI61832.1    ODYU01000586    SOQ35631.1    ODYU01000585    SOQ35630.1    NWSH01002532    PCG68054.1    NWSH01003169    PCG66835.1    JTDY01000511    KOB76839.1    JTDY01000743    KOB76037.1    JTDY01003098    KOB70157.1    JTDY01002536    KOB71226.1    NWSH01001196    PCG72157.1    GEZM01082533    JAV61335.1    GBGD01002523    JAC86366.1    JTDY01001071    KOB74965.1    GCES01008982    JAR77341.1    BABH01024878    ACPB03011704    ACPB03011705    ACPB03011706    ACPB03011707    ACPB03011708    ACPB03011709    ACPB03011710    ACPB03011711    ACPB03011712    ACPB03011713   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00501   AMP-binding
Interpro
IPR004244   Transposase_22        + More
IPR000477   RT_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR027124   Swc5/CFDP2       
IPR020845   AMP-binding_CS       
IPR042099   AMP-dep_Synthh-like_sf       
IPR000873   AMP-dep_Synth/Lig       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
272
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00099
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01290
outside
1  -  272
 
 

Population Genetic Test Statistics

Pi
229.195771
Theta
152.40338
Tajima's D
1.71174
CLR
481.519928
CSRT
0.834808259587021
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号