SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14307
Pre Gene Modal
BGIBMGA008138
Annotation
PREDICTED:_17-beta-hydroxysteroid_dehydrogenase_14-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.546
 

Sequence

CDS
ATGGTGGCCGAGGAACTTAAAAAAAACATTGATCAAGTTTTGCATGACAATAATGTCACAAGTTGGGAGGATCTTTTATCATTTGCATATAGAATTTTGCATGTAGATAAACAGAGCAATAACTCCCATTCACTTACTAAAAAAATTAAGGATAATTGTAAGAATAATTCCAATAAGACTTTGTTGGACGATGGGGTAAATTATGACAAGCAACAGCGTCCATTTAATAAAGTTGCAAAAATTGAGGGGAAAGTAAGTGATGGAGATTTAAAGGGTGCCTCACAACTATTATTTTCATCAGATTCTCTAGCTCCGAATAATGCCGACACTCTTCTGGCGTTGAAGTCGAAACATCCTGCACCTTTAACACCTGTTAGTGTGCCGCCACCACAGTCTTCCACAACTTTGCCTCGTGTGTCTCTTGATGACGTTCTCACCACAATTACATCTTTTAAAAACGGTTCAGCAGCCGGACTGGATGGTCTATCCCCGCAGCATTTCAAGGATTTAATCAATGTTTCTGCTGGTGATGTCGGGCGGTCTTTACTTAAAAGTATAGTCTCGCTTGTTAATTTAATGCTGGCGGGAAGTGTACCTGAAAGTATCGCTGATATTTTGTATGGAGCGAATTTGTGTGCTTTGATGAAGAGAGATGGCGGTATTAGGCCTATCGCTGTTGGCGGTACACTGCGCCGCATTGTATCCAGGCTTTGCTGCAAAGAGGTTCTGCCGATATTGAGTGGGATGTTCCGGCCGATACAGTTGGGCGTCGGTACAAAGGGCGGCTGTGAAGCTGCGGTACATGCGGCTCGCACCTTTCTTAAGGGGGGTGGTGCCGAAGTATTGGTGAAGGTGGATTTAAAAAATGCATTTAATTGTATCGATAGGAATGCTTTTCTCAAAGAAGTGAAGGAACACATACCATCTATCTACCCTTACCTTTATCAATGCTATGGTAATCCATCTAAGCTGGTTTATAAGGAGAACCTTGTGGAATCAGCGACGGGTTGTCAACAAGGTGATCCACTCGGTCCGGCGATTTTTAGTTTGGGGATACATCCAGTTTTGAGGGAGCTGAAGTCCAGCCTAAATTTATGGTATCTGGATGACGGAACATTGGGAGGGGACATTTCCACGGTCTTAAGGGATTTAGAATATCTAAAATCTGCTTTGGCCAGTTTGGGTTTAGAGCTCAATTTTGCTAAGTGCAATTATCAATACAGACGATCGCACGTTGAAATGGATTTCACTGGAAAAGTTGTTATTGTGACTGGGGCCAGTTCTGGTATAGGTGCAGCGTCTGCTATACTGTTCGCTGAATATGGTGCGACTTTGACTCTCGTGGGGAGAAACGAATCCAGACTAAGAGCTGTTGCCGAGAAATGTCACGCAGCAAAAGGAATCAGCCCCTTATGTGTCAGAATAGATCTGACCCATAAAGACAGTTGCGCTGTGGTAGTAACCAAAACTGTGACCGCGTTCAAAAGGATCGATGTCCTTGTCAACTGTGCCGGTAAAGTCCTCATAGGTTCGCTCTTCGATGAAAATATAGAGGCATTTGACGAGATGATCAATATTAATCTTCGAGTTCCGTACAGTCTCTCGCATCAGGCTCTGCCGTACTTGACGAAGACCAAAGGTAACATTGTCAACCTCACAGCCACTAAGTACGCAAGAGTCAGACATGGGTTTATGGGTTACTCGGTTGCAAAAGCTGGACTTCAGAAGTTCACCAAGATTGCGGCAATAGAATTAGCCACGGAAGGTGTTCGAGTAAATTCTGTGCAACCAGGATTGACCAGAACTAATATCCTGTCAAATCTGGCGATGTCTGAGGAAGAACGGCAGGTAGCCTACGAGAGGCTCTCGCAAGACATGAAGATTATTGAACCCGAAGAGGTTGCTAGGATGGTTGTCTTCGTAGCGAGTGGGATATGTCCTAATTTGAACGGTGCAGATTTGGATTTGGATGGTGCAACCTCTGTCATGTGA
Protein
MVAEELKKNIDQVLHDNNVTSWEDLLSFAYRILHVDKQSNNSHSLTKKIKDNCKNNSNKTLLDDGVNYDKQQRPFNKVAKIEGKVSDGDLKGASQLLFSSDSLAPNNADTLLALKSKHPAPLTPVSVPPPQSSTTLPRVSLDDVLTTITSFKNGSAAGLDGLSPQHFKDLINVSAGDVGRSLLKSIVSLVNLMLAGSVPESIADILYGANLCALMKRDGGIRPIAVGGTLRRIVSRLCCKEVLPILSGMFRPIQLGVGTKGGCEAAVHAARTFLKGGGAEVLVKVDLKNAFNCIDRNAFLKEVKEHIPSIYPYLYQCYGNPSKLVYKENLVESATGCQQGDPLGPAIFSLGIHPVLRELKSSLNLWYLDDGTLGGDISTVLRDLEYLKSALASLGLELNFAKCNYQYRRSHVEMDFTGKVVIVTGASSGIGAASAILFAEYGATLTLVGRNESRLRAVAEKCHAAKGISPLCVRIDLTHKDSCAVVVTKTVTAFKRIDVLVNCAGKVLIGSLFDENIEAFDEMININLRVPYSLSHQALPYLTKTKGNIVNLTATKYARVRHGFMGYSVAKAGLQKFTKIAAIELATEGVRVNSVQPGLTRTNILSNLAMSEEERQVAYERLSQDMKIIEPEEVARMVVFVASGICPNLNGADLDLDGATSVM

Summary

Uniprot
ProteinModelPortal
PDB
1SPX     E-value=7.24741e-25,     Score=285

Ontologies

GO

Topology

Length:
663
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.00346
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02061
outside
1  -  663
 
 

Population Genetic Test Statistics

Pi
271.644235
Theta
172.218149
Tajima's D
0.82929
CLR
0.41069
CSRT
0.614419279036048
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号