SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14289
Annotation
hypothetical_protein_RR48_04989_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.067
 

Sequence

CDS
ATGACTGAGCAAAAGGAACTAATAAAGAAACGTAGCAGCATCAAAGGTCGATTAACAGTGTTCGCGAGTCATCTAAAAACAATAGATGAATCAACGATCACTGCCACAGAGGTCAGGGAGTTACAATTGCGCATTGGTAAGATCGAAGCTTTATATCACTTATACGATGAGGTACAGTTGAAAATAGAGTGCAGCTCTGATAACATGGATATACAAATGGCTGAAAGAACAGAGTTTGAAACTCAGTATTATAAAACATGCGCTCATGCACATGAAATTCTAAATACATACCAAAGGCTACATGAGAAGATTGAAAACGCATCGAATGCTTCACATTCACGCGCTAATCATAGACTTGTTAAGTTACCTACCATCCAGCTGCCCAAATTTGGAGCGGATCCCAAGTACTACTTACCTTCTGCCATCAATCTTATTATTGGTGCTGATGTTTTCTGGGACATTTTGGGTTCTCAAAGAATTAAATTAGGGAATGGCAAGCCGATTCTTTATGAGACTAGACTTGGTTGGATAGTCTCTGGTCCAGTAACCAGTGGCCACACATCGACTTGGCCATGTAAAATTAAATGTAATGTCACTCAAGTTGATTCTATGACTTCTTATAATTTTAATGATGACATCCAAAACCAACTCATGCGTTTTTGGCAGCTTGAAGAAGTCTGTCCTCAGTCAAATCATTATTTCCCTGAAGAGAAGTTATGTGAAGAACATTTTGTTAAAAATACAACTCGCCTCGCAGACGGACGGTTTTGCGTAAGAATCCCATTGAAACAAGCGCCTGACGTTTTGGGAAGTTCTTATCAGCGAGCTAAACATTGCTTATTATCTTTGGAGCGTCGACTCAAAGGTGATGATTCATTTAGTAAAATGTACAAGGAATTTATGCGCGAGTATAAAAATCTTGGTCACATGTCAGAGTGCAAACCGAATATTGAGTTGCCTCATTACTTCATTCCACATCATGGTGTCCTTCGTGAATGTAGTACGACCACTAAGTTGCGCGTCGTATTTAATGCGAGCAGCCCTACTTCCTCAAGGGTTTCATTTAATGACATTCAAATGATAGGACCCACGGTGCAAGACGATCTTCTGTCAATTCTTTTACGTTTTCGGCAGCACAAGTATGTTCTTGTAGCTGACGTTGAGAAAATGTATAGGCAGATCGTCGTGCATGAAGCGGACAGACCGTTACAACAGATTATTTGGCGCGAAAACGAGTCAGATTCACTCAAATCATATGCTTTAAACAGAGTCAGTTATGGAACTGCTAGCGCACCCTATCTCGCTAGTAGATGTTTGAAACAAATAGGTATAGAATGTAAGGACCCCACGATAGCGGACATCATTATCCATGATTTTTATGTCGACGATTTGTTGACTGGAAGTGACTTCATCAGCGAAGCATTGCGCATCCGTGAGCAAGTTTCTGCTGAATTAGCATCAGCTTGCATGCCTTTGAGAAAATGGAAGTCCAATGAACCTCAACTGTTATCACAAGCCAGTCATCAACCATCCCTTGAATTAAAACTCGGAGATGCTGAACCTAATAAGACTCTTGGCCTCGGATGGGATTCAGAGTCAGACCAATTTCATTTTCCTGTCAATCCTGTCATTGTTAAGGGAAAAACAAAGCGTGACATCCTCTCTGTCATAGCTCAAATATTTGACCCACTTGGGATCTTATCACCTTTCATCATTTCGATGAAATTAATTTTACAAAGGTTGTGGCTTCAACGCTTATCTTGGGATGAGGAGTTGCCTTCAGAGATATACCAGGCGTGGATCGAAACTGTCCACAGCCTGCCTCATTTGAGCAGCTTGCGCATACCGCGACATGTCATTTGTGATTCTCACTCCCAGTTGGAGTTACACATTTTTACTGACGCGTCTGAGCGTGCATATGGTGCTTGTGTTTATGTGCGTAGTATTGACTACGACGATGCAGTCTCAGTCCAGCTACTTACCGCTAAGAGCCGGGTTGCTCCCATAAAGCCAACGACTATACCCCGACTAGAACTCTGCGGCGCGTTGATTGGTGCTCGAATTTCTGAGAAATGTGTAACTGCATTGCGTGCTAAATTCAACCGCGTTATATTTTGGTCAGATTCTACCATTGTTTTAGGCTGGCTAAAAATGTTGCCATCTAAATTACAGCCATTTGTGCGTAATCGTATTGCAGAGATTTAG
Protein
MTEQKELIKKRSSIKGRLTVFASHLKTIDESTITATEVRELQLRIGKIEALYHLYDEVQLKIECSSDNMDIQMAERTEFETQYYKTCAHAHEILNTYQRLHEKIENASNASHSRANHRLVKLPTIQLPKFGADPKYYLPSAINLIIGADVFWDILGSQRIKLGNGKPILYETRLGWIVSGPVTSGHTSTWPCKIKCNVTQVDSMTSYNFNDDIQNQLMRFWQLEEVCPQSNHYFPEEKLCEEHFVKNTTRLADGRFCVRIPLKQAPDVLGSSYQRAKHCLLSLERRLKGDDSFSKMYKEFMREYKNLGHMSECKPNIELPHYFIPHHGVLRECSTTTKLRVVFNASSPTSSRVSFNDIQMIGPTVQDDLLSILLRFRQHKYVLVADVEKMYRQIVVHEADRPLQQIIWRENESDSLKSYALNRVSYGTASAPYLASRCLKQIGIECKDPTIADIIIHDFYVDDLLTGSDFISEALRIREQVSAELASACMPLRKWKSNEPQLLSQASHQPSLELKLGDAEPNKTLGLGWDSESDQFHFPVNPVIVKGKTKRDILSVIAQIFDPLGILSPFIISMKLILQRLWLQRLSWDEELPSEIYQAWIETVHSLPHLSSLRIPRHVICDSHSQLELHIFTDASERAYGACVYVRSIDYDDAVSVQLLTAKSRVAPIKPTTIPRLELCGALIGARISEKCVTALRAKFNRVIFWSDSTIVLGWLKMLPSKLQPFVRNRIAEI

Summary

EMBL
NWSH01001945    PCG69607.1    NWSH01001014    PCG73111.1    KQ460970    KPJ10166.1    + More
KQ458793    KPJ04955.1    KQ460545    KPJ14069.1    RSAL01000402    RVE41913.1    KQ460205    KPJ16960.1    KQ459312    KPJ01687.1    KQ460500    KPJ14270.1    KQ460211    KPJ16510.1    GBBI01004211    JAC14501.1    GEZM01021505    JAV88969.1    GEZM01012999    JAV92824.1    GBBI01004140    JAC14572.1    GBBI01004139    JAC14573.1    NWSH01001201    PCG72150.1    GALX01003263    JAB65203.1    GALX01003264    JAB65202.1    GAMC01020552    JAB86003.1    GEZM01066274    JAV68017.1    GGMR01018506    MBY31125.1    GGMR01002340    MBY14959.1    GEZM01066272    JAV68024.1    ABLF02024568    ABLF02041590    LBMM01009461    KMQ88124.1    GGMR01005535    MBY18154.1    GGMS01004301    MBY73504.1    GGMR01014413    MBY27032.1    GGMR01017803    MBY30422.1    GANO01004788    JAB55083.1    GEZM01018629    GEZM01018623    JAV90127.1    GDUN01000088    JAN95831.1    GDUN01000087    JAN95832.1    GGMR01013586    MBY26205.1    ABLF02042806    GEZM01018702    JAV90048.1    GEZM01018619    JAV90138.1    GGMR01017408    MBY30027.1    GGMR01010750    MBY23369.1    GGMS01010815    MBY80018.1    GGMR01000407    MBY13026.1    ABLF02022040    ABLF02056888    GEZM01086715    JAV59020.1    GGMR01000961    MBY13580.1    GGMR01014230    MBY26849.1    GEHC01000939    JAV46706.1    LBMM01016286    KMQ84479.1    LBMM01016285    KMQ84480.1    LBMM01012240    KMQ86333.1    JXUM01113346    KQ565681    KXJ70776.1    GGMR01015704    MBY28323.1    GGMS01005792    MBY74995.1    GEHC01000894    JAV46751.1    ABLF02042264    GEHC01000864    JAV46781.1    ABLF02016109    ABLF02016113    AAZX01023505    GGFJ01000364    MBW49505.1    ABLF02013940    ABLF02036313    ABLF02066938    ABLF02066950    ABLF02004142    JXUM01030959    KQ560903    KXJ80414.1    ABLF02011447    ABLF02011449    ABLF02058523    GEHC01000898    JAV46747.1    GGMR01020322    MBY32941.1    NWSH01006923    PCG63188.1    ABLF02023723    GFTR01008874    JAW07552.1    GL769615    EFZ10365.1    LBMM01010417    KMQ87475.1    ABLF02041863    GEHC01000870    JAV46775.1    LBMM01009551    KMQ88039.1    ABLF02003232    ABLF02003233    ABLF02022909    ABLF02042631    PCG63186.1    ABLF02006088    ABLF02006089    ABLF02023600    ABLF02041631    ABLF02018588    ABLF02018590    ABLF02042430    GEHC01000865    JAV46780.1    LNIX01000036    OXA39969.1    ABLF02023842    ABLF02028949    ABLF02058391    KK114194    KFM61875.1    AAZX01023184    KQ973442    KXZ75531.1    ABLF02014076    GGMR01020500    MBY33119.1    LBMM01006539    KMQ90520.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    LBMM01009964    KMQ87756.1    LNIX01000011    OXA48901.1    GGMR01000448    MBY13067.1   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR000477   RT_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001606   ARID_dom       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
734
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.05047
Exp number, first 60 AAs:
0.00061
Total prob of N-in:
0.01920
outside
1  -  734
 
 

Population Genetic Test Statistics

Pi
350.011599
Theta
202.324637
Tajima's D
2.258236
CLR
0.108168
CSRT
0.917154142292885
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号