SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14283
Annotation
integrase_core_domain_protein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.205
 

Sequence

CDS
ATGAACAAAAACCGAAGAGGAAAATTCACAGCCAAAGCGACAGAAGGAGTATTCTTGGGATATGCGGAATATACAAAAGGTTTTAGAATATATATACCCGAAAGGAATGATGTTGTTATCAGCAGAGATGTAAAAGTAGTCGAAAAGATGCATTATAGCGGTACTCCTGCTGAGAAACGCGAAGGTCTTACTCCAGAACCTGAAACAGAACAAATTGAAATTCCAGAAAAAAGAAACAACATTAATGAGAACTTACCTTTTCAGGAACCTAACCCCCTTTATTCCAGCTCTAGTCAAGATCATGTTGATGAACCACCTCCCTCAAGTGGAAGACCACAAAGGGACGTGAGACCACCAGCATGGACCAAAGATTATGAGTTAAGTCGCTGCGTGACCATGTTTACGTCAGAAAATAATGACGACTATGACTGCTCTTTACTAACATACAAAGAAGCTGTGACTGGCACCGACAGACGAAATTGGGAGAAGGCGATACAATCTGAAATGGAATCATTACAGAAAAATAACACCTGGGTATTAGTAGACAAGTCAGAAGCCAAAGGACACAAAATACTGTCGAACAAATGGGTATTTCGGATTAAAGATGACGGTACGTACAAGGCTAGATTAGTCGTACGTGGATGCGAGCAGAAAGGAAACCTGGATTTCGAAGACATTTATAGCCCAGTAGTAAGTCAATCTGGATTAAAAACTTTATTAGCAATTGCCGCATCTAAATCTTACTACTTCATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGACTAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAGTCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCCTAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATAATTCTTACTCAGAGATCCTACATAAATGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTCGAAAACCCCACTAGAGAGGACGTTACAAAAGTGAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTATTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGCGACTCGGATTATGCTGGAGACCCATTGACGAGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACTGAAGCCGAGTACATAGCCGCAGCCGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTACAGGAAATAACCGGTTTGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGGTCGAAGCACATAGACGTGCGGTACCATTTTATACATGAACACTTCGTGCATGGATTAATAAATATTAGCTACTGTCCCACAGAAATTCAGTTAGCTGACGTAATGACAAAACCATTGTCAAAAGTAAAATTTGAAAGACACTGTGCAAGATTAATGCATGTATAG
Protein
MNKNRRGKFTAKATEGVFLGYAEYTKGFRIYIPERNDVVISRDVKVVEKMHYSGTPAEKREGLTPEPETEQIEIPEKRNNINENLPFQEPNPLYSSSSQDHVDEPPPSSGRPQRDVRPPAWTKDYELSRCVTMFTSENNDDYDCSLLTYKEAVTGTDRRNWEKAIQSEMESLQKNNTWVLVDKSEAKGHKILSNKWVFRIKDDGTYKARLVVRGCEQKGNLDFEDIYSPVVSQSGLKTLLAIAASKSYYFMTFDIKTAFLYGELSDEVYMKLPVGYETNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVLGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIILTQRSYINDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNLVSRKVENPTREDVTKVKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQEITGLDIKINLHVDNQSSIQLVKSGSFNKRSKHIDVRYHFIHEHFVHGLINISYCPTEIQLADVMTKPLSKVKFERHCARLMHV

Summary

EMBL
GBHO01016409    JAG27195.1    GEDC01029908    JAS07390.1    GECL01003258    JAP02866.1    + More
GBHO01040573    JAG03031.1    GBHO01040574    JAG03030.1    GBHO01035865    JAG07739.1    GBHO01006096    JAG37508.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    GDHC01005053    JAQ13576.1    GBHO01028636    GBHO01028635    JAG14968.1    JAG14969.1    GBHO01024362    JAG19242.1    GBHO01012744    JAG30860.1    GBHO01031779    JAG11825.1    GEZM01048830    JAV76370.1    GDHC01010945    JAQ07684.1    GGMR01009345    MBY21964.1    OIVN01002268    SPD02135.1    ABLF02042027    OIVN01003897    SPD14257.1    OIVN01000183    SPC75833.1    OIVN01000116    SPC74628.1    OIVN01001196    SPC91020.1    OIVN01001052    SPC89229.1    OIVN01000147    SPC75222.1    OIVN01002904    SPD07378.1    OIVN01004879    SPD19723.1    OIVN01001890    SPC98658.1    OIVN01001520    SPC94877.1    OIVN01001666    SPC96375.1    OIVN01000557    SPC82046.1    OIVN01003569    SPD12194.1    OIVN01001091    SPC89740.1    GDAI01002967    JAI14636.1    OIVN01002256    SPD02034.1    OIVN01002680    SPD05612.1    KQ484038    KYP38095.1    ABLF02043571    ABLF02045585    ABLF02057174    ABLF02063637    ABLF02063640    OIVN01006259    SPD29117.1    FJ544857    ACL97387.1    OIVN01000036    SPC73022.1    OIVN01001669    SPC96464.1    ABLF02026843    OIVN01002854    SPD06945.1    FJ544851    ACL97383.1    LBMM01008978    KMQ88491.1    JN402332    AFB73911.1    OIVN01005024    SPD20514.1    GEZM01078128    GEZM01078127    JAV63002.1    OIVN01001309    SPC92453.1    JN402333    AFB73912.1    FJ544853    ACL97384.1    FJ544856    ACL97386.1    FJ544854    ACL97385.1    KQ971338    KYB28117.1    GEZM01013586    JAV92451.1    JYDK01000067    KRX78390.1    KQ484186    KYP36645.1    KQ483417    KYP53032.1    JYDS01000349    KRZ11769.1    OIVN01005657    SPD23465.1    OIVN01000230    SPC76722.1    OIVN01004867    SPD19656.1    CM003607    KYP67664.1    KL367655    KFD60665.1    OIVN01005312    SPD21871.1    OIVN01005591    SPD23209.1    OIVN01004603    SPD18338.1    JYDS01000077    KRZ26987.1    KQ483702    KYP42748.1    OIVN01001534    SPC95017.1    OIVN01005059    SPD20680.1    GEZM01002084    JAV97376.1    JYDM01000512    KRZ81798.1    PSQE01000008    RHN40111.1    JYDO01000312    KRZ65659.1    NCKU01004452    RWS05910.1    LBMM01012772    KMQ86003.1    GEHC01000868    JAV46777.1    GEHC01000867    JAV46778.1    JYDU01000007    KRY00737.1    OIVN01002725    SPD05963.1    LXQA010000742    MCH80155.1    JXUM01118474    KQ566190    KXJ70335.1    JYDH01000102    KRY32233.1    KRY32232.1    CM003603    KYP76811.1    KYP76810.1    JYDR01000237    KRY65040.1    EF094939    EF094940    ABO36622.1    ABO36636.1    JYDJ01000235    KRX39370.1    OIVN01001729    SPC97049.1    LBMM01003976    KMQ92933.1    OIVN01004420    SPD17230.1    OIVN01004379    SPD17029.1    OIVN01000758    SPC85117.1    OIVN01006387    SPD32065.1    OIVN01001022    SPC88819.1    OIVN01004910    SPD19931.1   
Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13855   LRR_8
PF03106   WRKY
Interpro
IPR013103   RVT_2        + More
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR039537   Retrotran_Ty1/copia-like       
IPR025724   GAG-pre-integrase_dom       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF118290   SSF118290       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
648
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0520800000000001
Exp number, first 60 AAs:
0.02095
Total prob of N-in:
0.00589
outside
1  -  648
 
 

Population Genetic Test Statistics

Pi
131.093248
Theta
118.734367
Tajima's D
0.305373
CLR
604.1014
CSRT
0.454327283635818
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号