SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14279
Pre Gene Modal
BGIBMGA008170
Annotation
PREDICTED:_EH_domain-binding_protein_1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.695
 

Sequence

CDS
ATGGCGTCAGTTTGGAAGCGATTGCAACGCGTCAACAAACGTGCGGCCAAGTTCCAGTACACCGCCTCGTATCACAGGGTCGACTTGGAGACCTCGCCCAAATGGAAACCTAATAAGTTAAGTGTAGTCTGGACGCGGAGATCTCGGAGAGTCATCAGCGAGCCTCTAGAATGGGAGCCAACTCTCAAGGACCCTTTGAAGGGATCGGTGATATACAATCTACCAGAGAATCACACCGTGGCGGTCACTCTCTTCAAGGATTCGCGCACTAATGAACTGGAGGACAAAGACTGGACTTTTGTACTGGAGGATGTGTCGTTGACTGGCAAGCGGCGTCGGCTGGCCGTGTGCTCCGTGAACATGCGCAAGTACGCGAGCCTGGAGTCGTCCCAGCGGCCGCTGCTGCTGCGGCTGGAGCCCACCACGCACAAGATTGTGTCCGCCTCCCTGTCGCTCACGTTACATTGCGTGCTGCTCAGAGAGGGACAGGCTACGGACGAGGACATGCAGTCGCTGGTCAGTCTGCTGTCGGTCAACAACAACTCCGACATCGCCGTGCTGGAGGACCTGGACGAGGACGACTACACGCTGTCCGATGACTCCACTCGCCAGATGTTGGACTTCCGTCAGCAAATGGAAGAGATGACCCAGAGCCTCACGAACAGCGACCTGGCGGACACCCCGTGCAGCGTGCAGAGCCTCAACCTCGACCTCACGCCGCAGCAGGCCCCGCCCGACTCGCCCACCACCCCGGTGCCCAGAGACGACAGACTCGATTTAAAAATAAAAATCGATTTACCCAAAATCGATTCCGTGACTTCCACCCCGAAAATCGATAAAACGGAATTCAAGCCTCTAGTATTGAAGCCCAGGACGATAACGAAAAGGAACCTTAAGCCTTTGGAGTTAAAGACGAATCTCAACAGCATCGGGCTCGAGAAGGACGATGAGAACAGCTACGACAGCGACCAGACGCCGACCGCCGACGTGGACAAACTGCTCCCGGGGAGGTTCCACAGAGACAAGACGCCGGTCCAAGACCTGCTGGAGTGGTGCCAGGCGGTGACCCGCGACTACAAGACCTGCCGGGTCACGAACCTCACCACCAGCTTCAGGTCCGGGCTGGCCTTCTGCGCCATCATACACCACTTTCGACCAGACCTCATCGACCTGTCGGCGCTGGCGGGCGAGGGGGCGGAGGCGCACGTGCGGGCGGCGCTGGAGGCCGGGGCCGCGCTGGGCATCCCGCAGGTGCTGGCCGTGGCCGACGTGTGCGCGCGTCCGGCGCCCGACCGGCTAGCCATCATGACGTACCTGTTCCAACTGCGGGCGCACTTCACGGGCGGCGAGCTGCAGGTGGAGCAACTGGGTAACGACGAGACGGAGTCGTCGTACATGGTGGGGCGCCACGACACGGACGAGTCGCTGCCCCCCGAGCTGTTCAGCCGCGAGATCAGCACGCGCCGCTCCAGGACCGACCGCGCACGACCCAAGTCTGAAGAACTAGAAGACAAGAAGAATAGAGTGGAGGAGCGCGGCAGTCCGGAGCGCGGCGGGGTGCGGGCGCTGCTGGGCCGCGTGCTGTCCCCGCAGCAGCAGCCGCCCACCTGGTACACGGACCAGCCGCTACCCGCTCGGCCGGAAAAGCTGATGACCCGCAAGGAACTGACCGATCCTTTCGGGTCCGACGAGGAGGACGAGCCGGGACCCCGGGGGACGCCCGAGCCACGAAGCAACGGAAAACTGGAAACAGCGGTGGAGCCCGCGCCGGACCCGCCGCGCATGGAGCCGGCGGCGACGGACCCCCTCACCCCCCCGGCGCCCCCCGCCGAGCCTAAACCGGAAACGCCGGTCGCAGAGCTGCCCAAGCCCACTCCGCAACTGTTGTCGCGGCACGATGAGCTCAAAGAGCGAGCGAGACAGCTGCTCGAGGCCACCAAGAGAGAGGCGAGAGAGAAAGAGAGGATCAGGCGACAGAACTCTAAGGAGGATAAAGAACTCAATGGCGTTAAGAATGGCGACTTGAGTCCGAAGAAGATAATGACGGAGGAAGAGAGACAAGTGATGCTGCGGGAGCGCGCGCGGAAGCTCATAGCCGACGCGAAAGCTGGACTGGTCAGTCCGAGTTCGCCGCTGTCTCCGTCCCGGCCGCCCCGCGCCGGCGCCGTGGAGATCATCAGCAAGCAGTCGGTGCTGGACGAGCTCGCTGCAGAGGACAGACAGAGCGAGGACGCGAAGAGCACCAGGAGTAACTCGTGGGGCAGTGACGAGGCGCGGCGGTCCCCCCTGCAGTCCTTCACCGCGCTCGTGGACAGCCTGTCGCCCGAGGACCACGCCGCGGATGAGGGCAAGGAGTCCGGCTCGTACATCCAGAGCGAGCTGGAAGCCTTGGAGCGAGAGCAGGCCGCCATCGACCTCAAGGCAGCCGCCCTAGAGAAGCAGTTACGCCACGTCATGGAGGCCGCGGACAGCACCGAGGAGGAGGACAAATTGATGTCGCAATGGTTCAACCTAGTCAATAAGAAGAACGCACTCCTGAGGAGGCAGATGCAGCTGAACATATTGGAGCAGGAGGAGGACCTGAGCCGCCGCTGCGAGCTGCTGGCGCGCGAGCTGCGCCTCTCCCTCGGCGTCGACGAGTGGAGGAAGACTCCCGGGCAGAAGAGGAGGGAGAGGCTGCTGCTGCAGGAGCTGCTGTCCGCGGTCAACGAGCGAGACCGCCTGGTCCAGGAGATGGACGAGCAGGAGAAAGCGATCGCGGACGACGACGCAATCGAGCGGAACCTGTCGCACGTCGAGATCCAAAGGAAGAACAACTGCATCCTGCAGTAG
Protein
MASVWKRLQRVNKRAAKFQYTASYHRVDLETSPKWKPNKLSVVWTRRSRRVISEPLEWEPTLKDPLKGSVIYNLPENHTVAVTLFKDSRTNELEDKDWTFVLEDVSLTGKRRRLAVCSVNMRKYASLESSQRPLLLRLEPTTHKIVSASLSLTLHCVLLREGQATDEDMQSLVSLLSVNNNSDIAVLEDLDEDDYTLSDDSTRQMLDFRQQMEEMTQSLTNSDLADTPCSVQSLNLDLTPQQAPPDSPTTPVPRDDRLDLKIKIDLPKIDSVTSTPKIDKTEFKPLVLKPRTITKRNLKPLELKTNLNSIGLEKDDENSYDSDQTPTADVDKLLPGRFHRDKTPVQDLLEWCQAVTRDYKTCRVTNLTTSFRSGLAFCAIIHHFRPDLIDLSALAGEGAEAHVRAALEAGAALGIPQVLAVADVCARPAPDRLAIMTYLFQLRAHFTGGELQVEQLGNDETESSYMVGRHDTDESLPPELFSREISTRRSRTDRARPKSEELEDKKNRVEERGSPERGGVRALLGRVLSPQQQPPTWYTDQPLPARPEKLMTRKELTDPFGSDEEDEPGPRGTPEPRSNGKLETAVEPAPDPPRMEPAATDPLTPPAPPAEPKPETPVAELPKPTPQLLSRHDELKERARQLLEATKREAREKERIRRQNSKEDKELNGVKNGDLSPKKIMTEEERQVMLRERARKLIADAKAGLVSPSSPLSPSRPPRAGAVEIISKQSVLDELAAEDRQSEDAKSTRSNSWGSDEARRSPLQSFTALVDSLSPEDHAADEGKESGSYIQSELEALEREQAAIDLKAAALEKQLRHVMEAADSTEEEDKLMSQWFNLVNKKNALLRRQMQLNILEQEEDLSRRCELLARELRLSLGVDEWRKTPGQKRRERLLLQELLSAVNERDRLVQEMDEQEKAIADDDAIERNLSHVEIQRKNNCILQ

Summary

EMBL
BABH01026837    BABH01026838    KZ150393    PZC71038.1    NWSH01000055    PCG80143.1    + More
KQ459386    KPJ01227.1    ODYU01003768    SOQ42946.1    KQ982944    KYQ49012.1    GL888243    EGI64069.1    KK107139    EZA57698.1    KQ414856    KOC60095.1    QOIP01000003    RLU24887.1    KZ288430    PBC25844.1    GL445407    EFN89625.1    GBYB01002219    GBYB01002220    JAG71986.1    JAG71987.1    GDKW01000208    JAI56387.1    GFTR01008332    JAW08094.1    DS235123    EEB12203.1    GECL01002907    JAP03217.1    GBGD01000363    JAC88526.1    GEZM01007454    JAV95186.1    GEZM01007458    GEZM01007457    GEZM01007455    GEZM01007453    GEZM01007452    JAV95188.1    GEZM01007456    JAV95184.1    NNAY01000112    OXU30867.1    GBHO01036913    GBRD01001153    JAG06691.1    JAG64668.1    KQ435757    KOX75872.1    GFDF01000090    JAV13994.1    KQ971319    EFA00250.2    GFDF01000091    JAV13993.1    GEDC01003094    JAS34204.1    KQ434879    KZC09958.1    GEDC01009460    JAS27838.1    AJWK01004552    JR037568    JR037570    AEY57848.1    AEY57850.1    GEBQ01022832    JAT17145.1    GANO01002547    JAB57324.1    CH933808    EDW10863.1    KRG05541.1    CH916375    EDV98503.1    GDIQ01153209    JAK98516.1    KRG05543.1    GDIP01227563    JAI95838.1    GDIQ01049514    JAN45223.1    GDIQ01180296    JAK71429.1    GDIP01167221    GDIP01165670    GDIP01046043    JAM57672.1    GDIP01107426    JAL96288.1    GDIQ01076088    JAN18649.1    GDIQ01106025    JAL45701.1    GDIQ01155907    JAK95818.1    GDIP01060983    JAM42732.1    GDIP01060984    JAM42731.1    GDIQ01215593    JAK36132.1    CVRI01000074    CRL08109.1   
Pfam
PF10358   NT-C2        + More
PF00307   CH
PF12130   DUF3585
Interpro
IPR019448   NT-C2        + More
IPR022735   bMERB_dom       
IPR036872   CH_dom_sf       
IPR001715   CH-domain       
IPR029944   EHBP1       
IPR029928   Ehbp1l1       
SUPFAM
SSF47576   SSF47576       
Gene 3D
PDB
2D89     E-value=1.27103e-25,     Score=293

Ontologies

Topology

Length:
943
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01363
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00071
outside
1  -  943
 
 

Population Genetic Test Statistics

Pi
202.380587
Theta
20.54344
Tajima's D
1.328947
CLR
0.194765
CSRT
0.750512474376281
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号