SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14267
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.515
 

Sequence

CDS
ATGGCCAATTGTGAAAAGTTAGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCTACCTCGGTGGAAGCACGCTGCCCCACGTACTCTGGGGGGGGCAACAATTGCCAGGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGACGCGCTCCCTGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGTGATTCGGGTGCGATCATCCCCACCAAACCATCGGCGGGGAAAAAGAGGGGCCGAAGGAAGACCCCCGTAGTAACTTCCGACGACGGCGGTGCGTCATCCTCCAGCACTGAGGTGCCGGAAAAGACCATGGCCATCGAGGACGTGGCTCCGGTGATTTCGGGGCCTGCCGCGTCGAAAGACACGATGCCCGCACCCCAGCGGGCACCAGTAAGGAGGAGGGGTGCCGTGTCACCGGCGACATCGGTGGAGTCGATGTCGACGTCGGTTGCGTCTCTGGCTAGCGGGGACGAGACGTTTCGTGATCTCGACCTCGCGCTGGTCAATCTCGGTAAACTGCTGTCAACCGTGGCTGCCAAGGGCGCCCAACCAGGCAGCAGCTACCGGAAAAGGCTTCGGGAGGGAGCCGCTATGGTAAGGACGAGACTGATCCCCACCATGTCCAAGCTCTATGACTTGGTGGCGAGCCGGGAGGCTGAAAACAAAGGCCTCGTCGCACAGCTTGACTCCAGGGAGAGTCGCATCCCGGGGGACTCCTCGGCCTCGCGGGGAGAGACTTCCCTGTCGCCAGTGCCTACGCTGGCATGCTCTGGGCCCTCCGTGGGGACGATGGACACTAACGTGCCCTCGCAGGCTGCGATGAGTGTGGCGGCGCCTATGACAGCGCCCATCCCTGTGGCCCCTGTGACGCGAGCACTCACTCCCGTGCTCCCCCGACCCCCACGGAGAGTTGAGTTAAGGCCTGCGCCGCCTCCGTCGATACCGGCTGCCTCTGCATCCACACGGAGAGGAAGGGTAAGGCCTGCGCCAGCGCAGGCTGGCGACATCCGTTCGCCACTTGCGAAGATGGTGGACGAGTGGCCGGCGCTGCCACGGCCTAGGATTGCGGAGCCGCCTCTTTCGCCCCCGCGTGCTGCGGGGTCGCAGAGGCCAAACAATATGGCTGCTGGGATGGGGGGGGTGGATGACTGCCTCCCAAGCAGAGAGGAAATTGTGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGCTCCTCAATTCGTTCCGGAGACTGCATCCCGGTGCCAACAGCCGCGGTCAGCCCGCGGGATCGGGCCGCCCGGCCGACCTCCGCTCCTACCCCACCTGCGAGAGTGGTTCGGCGTGGAGGCCGGAACCAGAACAACAGAGGTGTGAGAGACCAGAATCCCGCCCCACGGTCCCAACCACAGCCTCGTCCCCTTCCTCCTCCCCCATCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAGGCGGGGCACCCAGGCATTGCGACAGACAGCGGCTCTGGCAGCTCCCCGGGGGGGTCGAGCGCCGACCGCTGCAGCCCGTAAAACAGCGCTAGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCGGCCGCTGGCAAGAAGAAAAGCAAGAAGAAGAAGCCGCGTGCAGCGCGGTCGGCTGCCGTTGTAGTGACATTGCTGCCGGCCGCCGCCGAAAAGGGCCTTACCTATAATAATGTGATGGCCCGGGCGCGCGCGGCTGTAAATTTGGAAGAAATCGGGGCAGAAGAAGGCCTCCGTTTCCGGCAGACTGCCAATGGGGCGAAGCTGCTGGAGTGTCCCGGTGCCGACAGCTCTGGCATCGCAGAAAAACTAGTGGCGACGCTCCGCGTGGCGCTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAAGAGGAGGTGGCAGCCGCGATAGCCGCCCAGGGTGGATGTGCTCCAGAGAGTGTGACCGTGGGTGAACTCCGCTCAGGGTACTCCGGGGCCAGGTCGGCGTGGGCGCGCTATCCGGTTGAGGCGGCTACCTTCTTGGCCACTCCTCCACCGGGAAGATCGACGGGGGATCCAGGGAGACTGCGAGTGGGCTGGATAGCAGCCCACGTGCGTCTTCAAGAACCGCGGGCCTGGAGATGCCTGCGCTGCTTTAGCACTGGACACGGCCTCGCCAGGTGCACCAGCACGGTTGACCGCAGTGGTCTCTGCTTCCGATGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCAGCCGGGCGCGGGGCAAACCATCGGGCAGGAGGCAAAGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGTCGCAAGGCAAAGCGCCGGCAGAAGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGTTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGAAACCTGAATCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGACGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTTGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTTGCTCCCCGCCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCTGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGTGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGGAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAAGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCCCCGCATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCTCGAAAGACACTGCACCCGGCCCGGATGGCATCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAAGGGCGCCCGGCGGATACTGCCGCTGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATTCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACAGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTCCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTAAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCAGACGACACGTTAGTCGTGGCCCGGGGGGGGAGTTTTGTTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATCCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGATTCTGGAAGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCTGTGTGGTCAGAGCGCGGAGGGCTCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAACAGGAAACGACTTGTCGTTGCCGAGTGTCGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCAGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MANCEKLVPQEGTARESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPTRSLIAGSMRSALASDSGAIIPTKPSAGKKRGRRKTPVVTSDDGGASSSSTEVPEKTMAIEDVAPVISGPAASKDTMPAPQRAPVRRRGAVSPATSVESMSTSVASLASGDETFRDLDLALVNLGKLLSTVAAKGAQPGSSYRKRLREGAAMVRTRLIPTMSKLYDLVASREAENKGLVAQLDSRESRIPGDSSASRGETSLSPVPTLACSGPSVGTMDTNVPSQAAMSVAAPMTAPIPVAPVTRALTPVLPRPPRRVELRPAPPPSIPAASASTRRGRVRPAPAQAGDIRSPLAKMVDEWPALPRPRIAEPPLSPPRAAGSQRPNNMAAGMGGVDDCLPSREEIVACISRAVAVEVGKHFAGLEEMLRSSIRSGDCIPVPTAAVSPRDRAARPTSAPTPPARVVRRGGRNQNNRGVRDQNPAPRSQPQPRPLPPPPSSMDEGWTEVVRRGTQALRQTAALAAPRGGRAPTAAARKTALAAVAAPREGRAPAAGKKKSKKKKPRAARSAAVVVTLLPAAAEKGLTYNNVMARARAAVNLEEIGAEEGLRFRQTANGAKLLECPGADSSGIAEKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRSGYSGARSAWARYPVEAATFLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSTVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRGANHRAGGKACFPSGDNTERNRRRKAKRRQKRKLARGALANVVIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDDGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHLVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDAPPEYDGEVPAEVPRITGAELRVAVRKMCSKDTAPGPDGIHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFVESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWILEAEALAADYQWRADLRARGVARPSPCVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKTGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=5.43127e-11,     Score=169

Ontologies

Topology

Length:
1903
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10936
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00020
outside
1  -  1903
 
 

Population Genetic Test Statistics

Pi
126.771246
Theta
116.222182
Tajima's D
0.739961
CLR
355.787397
CSRT
0.593920303984801
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号