SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14255
Annotation
TRAS3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.362
 

Sequence

CDS
ATGTTCGGAATCAGGACTCCCCCACCGAAAAGCGACAACTCGTCCCCAAATTTGGATGAAGGGGCTCTCAATGTTAGACGCAGTATAGGCGAGTGGGAAGCGGCAAACGCTGATCCTACTCCATCAATGACATGCATGACGAAGCAGACTGGCCCTGCTACAAACCCGAAAGCTCGTCTAACTCCATCGCGGGACGCTTCAGCCGCAGCCGGACTTGGACCATCAACCGGAACCCACAGTCCACAAAAATTAAAGAACGCGGACCGTATTGCGGAGGCAAGAGCCTGCCTACACAAGGGCAAGCTACACCTTAACGCCTCTCGCAATACCAAAACAGAAATAAAGAGTGTGGTTTTCGAAGTTCTGGAGCGGTTGTATCAGCTTGTAAAGGAGGCTGAGGCAGCCCTAAAATCAAAAAAGCCTAAAGACGGAACTAACGCAACTGTGGGGCTAGAGCCGGTACCTATAGTCACTGACTCTACCTTCACAGTCAGCGAGGATCCTAAGCTATTGAGCAAAATAGAGGAGCACAGCAAATTGTTGCTAGAAAGCAACAAAAAAATGGAGGAGCTAAGACTAGCGATGGAGAGACAGCAAGAAAGCTTAAAAAGTACTGCAACATATGCGAGCGCGACCGCCACTCTGAACGAAAAGCCACTACCAAAACGGAATACGTTACACTCACTGGTGGTAACCTCAAAAAATGAATCGGAAACTGGAGAAGAGGTTTTAGATAGAGTTAGAAAGGCGGTTGACGCAAAGGAGGGTTGGATTAAGGTTGAAAGAGTAAGGAAGGCGAAAGATAGGAAAATCATAATGGGCTTCAGAACGACAGAAGAAAGGAACAAAATAAAAGATAGATTTGGAAAAGAGGGAATAGACCTCGTTGTCGAGGAGGTGAAAAATAAAGACCCACTCCTGATCCTCAAAAACGTCCTACTGGTCAATACTGATGAAGATGTTCTCAGGGCTTTGAGGAACCAGAACAGGGATGTCTTTCGCGGTCTGGACAGCGAGGAGGACAGGTTGGGAATTAAATACAGAAGAAGAACCAGGAATCCCCACACGAATCACATCGTGATCAGCACCTCCCCCGCTATCTGGCGTAAAGTCTTGGAAGTTGGATATCTGCATATTGATCTTCAGCGGGTCAAGGCGGAAGACCAATCTCCACTTGTGCAGTGTACTCGCTGCTTGGGGTACGAACAGCAGACAACAAAATACCTCCCTATAAATATAGCCCAGATTAACTTACAGCGCAAAAAACTAGCAACTGACGAATTAATGATTGAGGCGAACAGGGAGAAAATTGACATTGCTATGATCCAGGAACCCTATGTCGGTGGAGGAAGCTTTATGAGGGACTACAGAGGCGTAAAAATATACCAAAGAAATGGGACGGACGAGGGAACGGTAAAAACAGCAATAGCCGTATTTAATAAAGACCTCGAGGTAAATATGATTCCACACTTTACCACAAACAACATCTCGATGGTAAGAGTCAAAATAGCTTCATGGGAAATGTATGTCGTAGCATTCTACTTCGAGCCTGACCAACCAATCGACCCCTACCTAGAAAAATTAAGAGAAATAAAAACAGAATTGGGCACAAAGAAAATAATTATGGGGGGAGATATAAATGCAAAAAGCACCTGGTGGGGAGGGTTAAAGGAAGATAGTAGAGGAAGATCTGTGTCAGGAGCTATAGAAGAAATGAGAATGCAAATCCTAAATACCGGGGATACTCCGACTTTCTACACAATCAGAGGAAGCAAGATTTATAAAAGCTTCGTAGATATCACTCTCTGCTCAGAGAATATTTACGATCTTGTTGAGGACTGGGAAGTGAAGGACTTCATCAGCTCGGATCATGGTGTGATTACAATGAAGATTAAACTTCAAAGACAAAGAGGGAAAGAGATAGTGAGAACGACTAGATTATACAACACGAAGAAAGCGGACTGGGAAAAATTTCACAATAAGTTGACTGAAACAAAAAAAGATTACAACATACAATTAGATAAAGTTCAACAAATTAAAACTAGAAATGAATTGGAAAAATTTATAGAGACATATACTAAAGCAATGACCGATACATGTAAAAAAGTAATACCAATGAAGAAGAAAAAGGAAAAAGTTAACTTACCATGGTGGTCCGATGAACTCCGGAGATTGAAGAAGGACGTGATCACGAAGAAACGAAGAATCCGATGCGCAGCCCCAATCCGGAGGGAGAGTGTGATAAAAGAGTATCTGGAAGCAAAGGAAAAATATGAGAATGAAGTAAAAACTGCACAAGTAGAAAGCTGGAAGAACTTCTGCAATAAACAGGACAGAGAAGGAGTATGGGAAGGAATATATAGGGTCATTAGGAAAACATCGAGACAACCGGAGGATATGCCATTGATCAAGGATGGGAAATGCCTAGAACCGGAAGAATCGGCACAACTGCTGGCTAATACCTTTTATCCAAACGATACCGAAGAAGGGGAGAACTCATACCATCGCAAAGTAAGGAGCATGGCCAAACAGATAAACGAGGACCATGGTGAGCATGACCCGTCGTTTACATGGGACGAGCTACAAGCCTCGATGAAGAGTTTCAACCCCAAAAAAGCTCCAGGTGCGGACGGCTTCACAGCGGACATTTGTGAGCAGATAATGTTAGAAGATCCAAATCTGCTTCTAGCTACAATGAACAAATGTCTTGAGCTGGGTTGCTTTCCAACAATTTGGAAGGAAGCCACTGTAGTTGTGCTGAGGAAACCCGGGAAAACAGATTATACAAACCCCAAGGCATATAGACCGATAGGCCTTCTACCAGTACTCGGGAAAGTATTGGAGAAAATGACATTTAATAGAATCAAATGGCATATCCTTCCAAAATTAAGTAAAAGGCAATATGGGTTTATGCCCCAGAGATGTACGGAGGATGCCCTTTACGATTTGGTGAGCCATATTAGAAAAAAGTTGAAGGAAAAGAAACTCATCACTATGGTCTCACTGGATATTGAAGGGGCCTTCGACTCGGCATGGTGGCCTGCCATTAGACTCAGATTAGCCGAAGAAAATTGCCCAATAGATTTGCGGAAGGTTCTTGACAGCTATCTGGAAGACAGAAGAGTCGGAGTTAGATATGCTGGTCATGAATGTAAAAAGAAAACGGAGATAGGATGTGTGCAGGGATCAATCGGCGGACCCCTGCTATGGAATTTACTATTGGACCCCCTGCTGAAGAAATTGGAGAACGAGGGTGTTTATTGCCAGGCGTTCGCCGATGACGTCGTGCTTGTATTTGATGGTGAGACAGGGTTGGGCATGGAGAGGACAGCAAACAGAGTGCTGTCTTCTGTTGAAAAATGGGGAAAAAACAACAAATTGAAGTTTGCACCCCACAAGACCAAAGCCATGCTCATTACTAACAAACAAAAATTTGACGCACCAAAACTTAACATGGGAGGTACAACAATACAAATGAGCGATGAAATAAAAATTTTAGGTTTGATCATAGACAAAAAGCTAACATTCAACAACCATGTAAAGACAGCAACAAACAAAGCCATACAGATTTACAAACAGGTTGCCAGGGCGGCGAGAGTAAGCTGGGGGCTCCACCCCGATGTAATCCGTGCGATTTACACCGCGGTGGTGGAGCCCATTATCTTGTATGCGGCAAGTGCCTGGGCACCGGCTGCAGAGAGGGTATCGGTTCGCAAGAGTCTTGGCGTAGTACAGAGGGGATTTGTTCAAAAACTTTGCCGAGCATACCGTACAATCTCCCTCAACGCGGGGCTCTTGTTGACAGGACTGCTGCCACTGGACCTTAGGGTAAAAGAAGCAGCAACCCTGTACATGGCCAGAAAGGGTTACCCCACAGCCATAATTGGCGATTGGGAAATAGAAAGGATGGAGCCTGTCACTGTGATGGAACACCCTGCCGAGAGACTAATCATCAAATATGAGAACTTGGAAAACGACGAACAAACAAAGATTGCAATAGACAAATGCAATGTCCAGCTCTACACAGATGGAAGTAAAATTGACGGATTTGTCGGCGCTGCATATACTAAATGGATAGAGGGAAAAGAACAAAAACACAAAAAGCTGAAGCTGATGTCCTGCTGCACAGTTTTTCAGGCCGAGCTATTCGCGATAAATAGCGCCACTGAGGAGATCCTAAGATGTTCTGAGGACTCTTTTGGGATCTTCAGTGATTCGAGATCTTCGCTAGACATACTCAAAAATGGGAACAGCACACACCCTCTAGTCACAAAAATCACTAAAAACATAAACAACATTAAACTCCAGAAAAAGCAGATTACTCTATACTGGATAAAAGCTCATAACGGACTTGAAGGAAATGAAAGAGCCGACCAACTGGCAAAAGAAGCAGCGAAAAAGAAAGCAAAGCCTGAATACGATAAGTGCCCTATAGCATTCGTGAAAAGACGGATTCGTGAAGAATCCATCGACGAATGGAGCGAAAGATATGAGGCAGGCACAACAGCAGGGACTACAAAACTATTTTTCCCTAATGCAGCAGCTGCAAAGAAAATAATAGACACAATTAAACCGACAGGTGTTATGACACAGATTCTGACTGGACACGGTGGCTTCTCCGAGTACCTGGCTAGGTTCAGGTGCAAGGAGAGCCCAGCGTGTCCTTGTGACGGTGGTACGCCGGAGACGATCCCACACATATTAACGGAGTGCCCAATATCCGGGCCTGAGAGATTCAATATAGAACAATTAATAGGCGTAACAATTAAAACAGAAAATTTCCAGAAGCTAATATCCCAAAAAGAAACACAAGAGCAGTTTCTAGAATACTGTATAAAAGTTTGTAAAAAAGTAATAGTAAGAAACAAATAG
Protein
MFGIRTPPPKSDNSSPNLDEGALNVRRSIGEWEAANADPTPSMTCMTKQTGPATNPKARLTPSRDASAAAGLGPSTGTHSPQKLKNADRIAEARACLHKGKLHLNASRNTKTEIKSVVFEVLERLYQLVKEAEAALKSKKPKDGTNATVGLEPVPIVTDSTFTVSEDPKLLSKIEEHSKLLLESNKKMEELRLAMERQQESLKSTATYASATATLNEKPLPKRNTLHSLVVTSKNESETGEEVLDRVRKAVDAKEGWIKVERVRKAKDRKIIMGFRTTEERNKIKDRFGKEGIDLVVEEVKNKDPLLILKNVLLVNTDEDVLRALRNQNRDVFRGLDSEEDRLGIKYRRRTRNPHTNHIVISTSPAIWRKVLEVGYLHIDLQRVKAEDQSPLVQCTRCLGYEQQTTKYLPINIAQINLQRKKLATDELMIEANREKIDIAMIQEPYVGGGSFMRDYRGVKIYQRNGTDEGTVKTAIAVFNKDLEVNMIPHFTTNNISMVRVKIASWEMYVVAFYFEPDQPIDPYLEKLREIKTELGTKKIIMGGDINAKSTWWGGLKEDSRGRSVSGAIEEMRMQILNTGDTPTFYTIRGSKIYKSFVDITLCSENIYDLVEDWEVKDFISSDHGVITMKIKLQRQRGKEIVRTTRLYNTKKADWEKFHNKLTETKKDYNIQLDKVQQIKTRNELEKFIETYTKAMTDTCKKVIPMKKKKEKVNLPWWSDELRRLKKDVITKKRRIRCAAPIRRESVIKEYLEAKEKYENEVKTAQVESWKNFCNKQDREGVWEGIYRVIRKTSRQPEDMPLIKDGKCLEPEESAQLLANTFYPNDTEEGENSYHRKVRSMAKQINEDHGEHDPSFTWDELQASMKSFNPKKAPGADGFTADICEQIMLEDPNLLLATMNKCLELGCFPTIWKEATVVVLRKPGKTDYTNPKAYRPIGLLPVLGKVLEKMTFNRIKWHILPKLSKRQYGFMPQRCTEDALYDLVSHIRKKLKEKKLITMVSLDIEGAFDSAWWPAIRLRLAEENCPIDLRKVLDSYLEDRRVGVRYAGHECKKKTEIGCVQGSIGGPLLWNLLLDPLLKKLENEGVYCQAFADDVVLVFDGETGLGMERTANRVLSSVEKWGKNNKLKFAPHKTKAMLITNKQKFDAPKLNMGGTTIQMSDEIKILGLIIDKKLTFNNHVKTATNKAIQIYKQVARAARVSWGLHPDVIRAIYTAVVEPIILYAASAWAPAAERVSVRKSLGVVQRGFVQKLCRAYRTISLNAGLLLTGLLPLDLRVKEAATLYMARKGYPTAIIGDWEIERMEPVTVMEHPAERLIIKYENLENDEQTKIAIDKCNVQLYTDGSKIDGFVGAAYTKWIEGKEQKHKKLKLMSCCTVFQAELFAINSATEEILRCSEDSFGIFSDSRSSLDILKNGNSTHPLVTKITKNINNIKLQKKQITLYWIKAHNGLEGNERADQLAKEAAKKKAKPEYDKCPIAFVKRRIREESIDEWSERYEAGTTAGTTKLFFPNAAAAKKIIDTIKPTGVMTQILTGHGGFSEYLARFRCKESPACPCDGGTPETIPHILTECPISGPERFNIEQLIGVTIKTENFQKLISQKETQEQFLEYCIKVCKKVIVRNK

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00075   RNase_H
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR013604   7TM_chemorcpt       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=7.62039e-66,     Score=642

Ontologies

Topology

Length:
1623
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19924
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1623
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
3.77422
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号