SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14211
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.817
 

Sequence

CDS
ATGCCGATTGGGAAAGTTGAAAGTTTTGATATGGGATCTCAAAATTGGGACACATACATTCGTCGTGTAAAACAATTCATGGAACTCAACGACATTGAACAGAGACTTCACGTTGCAACGCTCGTAACCTTAGTTGGGTCTGAGTGCTATGACTTAATGTGTGACTTGTGTGCTCCGGACTTACCAGAAGAAAAGGATTTCGACATACTCGTAAAATTAGTCAAAGATCATCTAGAACCTGAAAGATCGGAAATAGCAGAACGTCATATCTTCAGGCAAAGAAAGCAGCAAAATAACGAAAGCATTCGTTCCTACCTACAAAGTTTGAAACATTTGGCTAAAACTTGCAATTTCGGCATCACATTAGAAATTAATCTACGCGATCAATTCGTATCAGGATTATATAGTGAGGAGATGCGATCAAGGCTGTTTGCTGAAAAAGATATAGATTACAAGCGCGCTGTTGAGTTGGCATCAGCACTGGAAGCAGCGGATCGACATGCGATGGCGGCTGGGGGCACTGGGGGCAGCTCACAGGCTGCGTCCGAGAGCGAAGGCATGCATCGGGTCGGCGGAGCGCGCGCGGAGGCTCGCTGCGCCTGCAGACGCTGCGGCAAGCTGGGCCATGCGGAGGGTCGGTGTCGGTACAAGCACTACACCTGTGACTCATGTGGCGAGAAGGGACACCTAAAATCAATGTGTCGGAACCGTAAAGGTAACCAAAAGATTGAAAAAAACCGAGCAATGCCTCTTAGACGAAGAATCCCAGCCGAATCCATACATATTGATCACGGTTGTCTTGTATGGGGTTACAGAATAATAATTCCAACTTCATTGCGAGAGACTGTGTTACAGGAGTTACATGAGGGACATCCGGGTATTGTTAAGATGAAACAATTAAGCCGGAACTACGTATGGTGGGAGACAGTCGATGCGGACATTGAACGTGTATGTGCTCAGTGCCAGGCCTGTCGATCTCAGCGCGCTGCACCACCATCGGTGCCGCTGCACTCGTGGCCATGGCCGGAAGAGCCGTGGGCGCGCCTTAATCTTGATTTCTTGGGACCGTTTAATAACAAATATTACTTAATTATAGTGGACGCTCATTCAAAATGGATCGAGGTGGAAAAATTGAGCTGTACATCAGCCACGGCAGTAATCGCATGTCTCAGACGATTGTTTGCTCGATTTGGCTTAGCAAAAAAGGTAGTAACTGATAACGGACCACCTTTCTCGTCGATCGAATTTAGAACATATTTAAGTAAAAACGGTATAAAACATTTACCGGTGGCTCCGTATCATCCATCTAGCAATGGTGCAGCGGAAAACGCCGTAAAAACCATAAAAAGAGTGTTGAAAAAGGCTTTAATTGAAAAGGAAGACGACAATACCGCCTTGACAAAATTTCTCTTTATGTACAGAAATTCTGAGCACAGCACTACAGGGCGCGAACCAGCAGTTGCTTTGTTCGGACGTCGCCTGCGTGGAAGACTGGATCTGTTGCGTCCAAATACTAGCTCCATAGTACGAGAAGCACAGCTGGCAAGCGAAAGCTATAATGCAGGCACAGCCGGATATAGGGAGGCGGCAGAAGGAGACTCGGTCCTATTGCAAGATTTCACACAGGGAAAAAAGAAATGGACCACAGGAACAATAAAAAACCGCTCAGGTCCGGTGACATACAGGGTAACAGCAGATGACGGGCGGGTACACAAACGTCACATCGACCAGATTTTAATAAGTAATAATAGTCGAAAATCACGTTATTCTTTGTCCAAATTAAACACTGATTTCGAGACAAAATCAGTAAATGATAGTGTGGGTGAAGTTCGGGAAAGTCCGTGTATGACCGGAGAAAAGGAGCTCAACTCCAGCTATGACACGGGACCGGAAAGTCCACAACCTGTGACTCCTAGTCACTCGCCGGCGCCGAATATCTTGCAACCATCGCGTCAGCGCCGTAAAGCTGCTTTAACGTGTATTCAGAGAATTAAGGACCAAAATTACTAA
Protein
MPIGKVESFDMGSQNWDTYIRRVKQFMELNDIEQRLHVATLVTLVGSECYDLMCDLCAPDLPEEKDFDILVKLVKDHLEPERSEIAERHIFRQRKQQNNESIRSYLQSLKHLAKTCNFGITLEINLRDQFVSGLYSEEMRSRLFAEKDIDYKRAVELASALEAADRHAMAAGGTGGSSQAASESEGMHRVGGARAEARCACRRCGKLGHAEGRCRYKHYTCDSCGEKGHLKSMCRNRKGNQKIEKNRAMPLRRRIPAESIHIDHGCLVWGYRIIIPTSLRETVLQELHEGHPGIVKMKQLSRNYVWWETVDADIERVCAQCQACRSQRAAPPSVPLHSWPWPEEPWARLNLDFLGPFNNKYYLIIVDAHSKWIEVEKLSCTSATAVIACLRRLFARFGLAKKVVTDNGPPFSSIEFRTYLSKNGIKHLPVAPYHPSSNGAAENAVKTIKRVLKKALIEKEDDNTALTKFLFMYRNSEHSTTGREPAVALFGRRLRGRLDLLRPNTSSIVREAQLASESYNAGTAGYREAAEGDSVLLQDFTQGKKKWTTGTIKNRSGPVTYRVTADDGRVHKRHIDQILISNNSRKSRYSLSKLNTDFETKSVNDSVGEVRESPCMTGEKELNSSYDTGPESPQPVTPSHSPAPNILQPSRQRRKAALTCIQRIKDQNY

Summary

Uniprot
ProteinModelPortal
PDB
3S3N     E-value=1.61222e-09,     Score=152

Ontologies

Topology

Length:
669
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000780000000000001
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00014
outside
1  -  669
 
 

Population Genetic Test Statistics

Pi
15.583987
Theta
18.061788
Tajima's D
-0.862575
CLR
14.332062
CSRT
0.167291635418229
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号