SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14206
Pre Gene Modal
BGIBMGA009311
Annotation
PREDICTED:_uncharacterized_protein_LOC105842116_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.392
 

Sequence

CDS
ATGGATTCGTTAAAACCACCGCCACCATTATGCCTCATGGGCGACTTGAAACAAAATTTTCAAAAATGGACACAGCAATATGATATTTATATGATTGCTAGCGGGACGGAAGGTGATGAAAAAATTAAAGATAAGCAGAAAAAGGCAATCTATTTGCACTGCCTAGGTGCAGAAGCACTAACCATATACAATGGTTTTAAGAACAAAGAAAAGTTATCTTATGTGGAAGTAAAACAGAAGTTTAATGAATATTGTTCGCCACCCGGAAATGAAACTTTTAGCAGACATGTCTTCTTCAGCAGAAAAAAGAGAGATGGAGAAAGTTTTGATGAATTTTTCTGTACGTTGAGAAAATTGGCGGGAGACTGTGGGTTTGCAGACCTAGAAGAAAGCTTAATAAGAGACCAAATCATATTAGGCTTAAATGATGCCAAATTAACAGAAAGATTGCTTAAGGAATCGACCTTAACATTGGATAGCTGCATGAAAATATGTAAAGTGGCTAAGAGTGCTGCAAAACAGGTTCAAGTCATGACAGAAAAGACAGTTGAAGCTGTTACAAGAAAACAAGAATCTCGAAGCAGAATGCCTAATCAGAATAAAACCAGTTTTAATAATAAACAACATCTAGGTAAGAGTGCAGAAGGATCAGTAAGGTTGAAGAATAATAATTGTGAAAGATGCGGAGGAGTGCATTCTCATCGATCCTGCCCAGCCTTTGGAAGGAGATGTGCTAAGTGTAATCGATATGGACATTACATGCAGATGTGCAGAACAGTTGGTGCTGTGTATGTCAGCGATGATGATAGTGATGACTCATTAGTAGTGGGGTCAGTAACTGTGGGCCAGGTTGATACAGAGGACTGGATCGTTGAGGCAAAAGTGAGAGGACAGAAGATGAAGTTCAAAGTGGATACAGGATCGCAGGTTAATATTTTGACTAGTGCTATAGTGAAAAAACTAGACTTAAAAATGACAGAAACTTGTACAAAATTAAAAAACTTTGATGGCTCAACTATAGAAACAGTAGGTATGACTAAAACTATAGTGAAATTCAATAAAAAAAAGTATGTACTTGACTTTTATGTGGTAAAATTTAAAACTACTAATGTGCTGAGCTATAAAGCTGCTGTGCAGTTGGGTTTAATAAACAAAGTTGAAAATATTTCAAAGGAATATGTAGTTCAGGACATTGGTGAATACAAAGATTTGTTTCATGGCTTAGGAAAATTGAACTATGTATACAAAATTAAATTAACAGACAATTGCTAA
Protein
MDSLKPPPPLCLMGDLKQNFQKWTQQYDIYMIASGTEGDEKIKDKQKKAIYLHCLGAEALTIYNGFKNKEKLSYVEVKQKFNEYCSPPGNETFSRHVFFSRKKRDGESFDEFFCTLRKLAGDCGFADLEESLIRDQIILGLNDAKLTERLLKESTLTLDSCMKICKVAKSAAKQVQVMTEKTVEAVTRKQESRSRMPNQNKTSFNNKQHLGKSAEGSVRLKNNNCERCGGVHSHRSCPAFGRRCAKCNRYGHYMQMCRTVGAVYVSDDDSDDSLVVGSVTVGQVDTEDWIVEAKVRGQKMKFKVDTGSQVNILTSAIVKKLDLKMTETCTKLKNFDGSTIETVGMTKTIVKFNKKKYVLDFYVVKFKTTNVLSYKAAVQLGLINKVENISKEYVVQDIGEYKDLFHGLGKLNYVYKIKLTDNC

Summary

EMBL
KK118858    KFM74040.1    MRZV01000519    PIK48493.1    GEZM01079607    GEZM01079598    + More
JAV62391.1    HADY01023773    HAEJ01006887    SBS47344.1    HADZ01022257    SBP86198.1    ABLF02013930    ABLF02013934    AERX01076149    AERX01070080    GCES01096219    JAQ90103.1    GGMR01000868    MBY13487.1    HAED01014930    SBR01375.1    MRZV01000033    PIK61397.1    GACK01009641    JAA55393.1    MRZV01000161    PIK56894.1    GCES01104253    JAQ82069.1    GEZM01020000    JAV89472.1    GEZM01050997    GEZM01050995    JAV75219.1    GBHO01031825    JAG11779.1    GEZM01051395    JAV74977.1    AGBW02008504    OWR53150.1    MRZV01000718    PIK45343.1    MRZV01000618    PIK46835.1    GFAA01002468    JAU00967.1    ABLF02010707    GGMR01004179    MBY16798.1    GEZM01102055    GEZM01102054    GEZM01102053    GEZM01102051    JAV52011.1    GEGO01004362    JAR91042.1    ABLF02041541    GEZM01097791    JAV54106.1    GEZM01041944    JAV80090.1    MRZV01000576    PIK47528.1    ABLF02038957    GEZM01001973    JAV97431.1    GDKW01000526    JAI56069.1    ABLF02007384    GBHO01036465    JAG07139.1    GEGO01007539    JAR87865.1    ABLF02008456    GBHO01004090    JAG39514.1    MRZV01000723    PIK45255.1    KK122208    KFM82237.1    GFPF01012437    MAA23583.1    GDHC01013957    JAQ04672.1    GEZM01016880    JAV91071.1    KV461054    OCA14957.1    GEZM01066276    JAV68015.1    ABLF02011977    GGMR01014455    MBY27074.1    GEZM01050758    JAV75411.1    ABLF02041865    GBHO01022049    GBHO01022048    JAG21555.1    JAG21556.1    GBBI01004851    JAC13861.1    GEZM01043682    JAV78912.1    HAED01020456    SBR07020.1    GBBI01004852    JAC13860.1    KF319019    AIE48224.1    GEGO01004665    JAR90739.1    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    GEZM01001974    JAV97427.1    GFWV01003962    MAA28692.1    ABLF02019772    NCKU01019406    RWR98729.1    GEFM01002416    JAP73380.1    MRZV01001756    PIK36039.1    CM012440    RVE73710.1    LSMT01000199    PFX23692.1    GBHO01013729    JAG29875.1    GBGD01000115    JAC88774.1    ABLF02026678    ABLF02026682   
Pfam
PF00078   RVT_1        + More
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00665   rve
PF03732   Retrotrans_gag
PF17917   RT_RNaseH
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
IPR038081   CalX-like_sf       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF141072   SSF141072       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
423
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02207
Exp number, first 60 AAs:
0.0129
Total prob of N-in:
0.00111
outside
1  -  423
 
 

Population Genetic Test Statistics

Pi
3.375172
Theta
8.309396
Tajima's D
-1.753761
CLR
39.690405
CSRT
0.0283485825708715
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号