SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14204
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.417
 

Sequence

CDS
ATGAAAGCAAGAGTACGGACAGAAAAGCTAGGAGAACACTTTCACATCAAAAAAGGAGTTAGACAGGGATACCCCCTTTCACCCAAACTTTTCTCTGCAACCCTAGAACATGTGCTTCGTCAGCTCGAATGGGACGATTACGGTATTAATATTAATGGAGTGTTACTAAATCATCTGAGATTTGCCGACGACCTCATACTTATAAGCGAAAATCCAGAAACTTTACAAAAAATGATTGAGCAACTTGTATGTGAAAGTGAAAAAGTTGGACTATCATTGAACACAAACAAAACAAAGCTGATGACAAACTACAAAAAAGTCCCTATCAAACCTTACAACACAGCTAAATTAGAATATGTAAATGAGTATACATACCTCGGCCAAATCATATCCCCCAAAGACCTCACAGCAAAAGAAATCAGTAACAGAATAAATATAGGATGGAAAAGTTACTGGGCATTAAAAGATGTCATGAAGAATTCAGAAATACCTGTTAAGGCAAAGAAGAAAATATTTAATACATGCATTCTTCCAAGTATGACCTATGGATGCCAAACATGGGGATTGACAAATAAGAACATAAAATCTTTAGAAATTTGTCAACACCGAATGGAAAGAAGTATGTTAAACATGACATTAAAAGATAAAATACGGTTAACAAAAATAAGAAAACAAACAAAGATCATAGATATAAAATACCGAATACAACAACTGAAATGGAAATGGGCTGGACATTTAATTCGAGATAAAACAGAAAAATGGGCTAAAGGAGTGACAGAATGGTGTCCTAGATATAAAAAGCGAAATAGAGGAAGACAACAACGTAGATGGGAAGATGACATCAAAAAAGCGGCAGGAACGACTTGGATGAGAAAAACGCAGGATAGATTATTATGGAGAACCCTTGGGGAGGCCTATGCTGTACAGCAAGACGATCAAGAAACCGGTGTCGAATAA
Protein
MKARVRTEKLGEHFHIKKGVRQGYPLSPKLFSATLEHVLRQLEWDDYGININGVLLNHLRFADDLILISENPETLQKMIEQLVCESEKVGLSLNTNKTKLMTNYKKVPIKPYNTAKLEYVNEYTYLGQIISPKDLTAKEISNRINIGWKSYWALKDVMKNSEIPVKAKKKIFNTCILPSMTYGCQTWGLTNKNIKSLEICQHRMERSMLNMTLKDKIRLTKIRKQTKIIDIKYRIQQLKWKWAGHLIRDKTEKWAKGVTEWCPRYKKRNRGRQQRRWEDDIKKAAGTTWMRKTQDRLLWRTLGEAYAVQQDDQETGVE

Summary

EMBL
FJ265561    ADI61829.1    KZ150485    PZC70710.1    FJ265564    ADI61832.1    + More
KZ149912    PZC78089.1    KZ150108    PZC73382.1    ODYU01004982    SOQ45402.1    FJ265542    ADI61810.1    KZ150317    PZC71439.1    EF113399    EF113400    ABO45233.1    GFTR01005437    JAW10989.1    GBBI01004876    JAC13836.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    FJ265551    ADI61819.1    RSAL01002362    RVE40503.1    FJ265550    ADI61818.1    FJ265549    ADI61817.1    FJ265545    ADI61813.1    GBGD01000380    JAC88509.1    FJ265563    ADI61831.1    FJ265543    ADI61811.1    FJ265544    ADI61812.1    RSAL01000016    RVE53061.1    AAGJ04144474    NWSH01004509    PCG65028.1    FJ265562    ADI61830.1    KZ150072    PZC74016.1    ODYU01008249    SOQ51673.1    ODYU01004088    SOQ43598.1    KZ149985    PZC75698.1    KZ149907    PZC78256.1    UZAG01000503    VDO08661.1    MRZV01002136    PIK34564.1    RSAL01002130    RVE40575.1    MRZV01000899    PIK42833.1    GFAC01005640    JAT93548.1    MRZV01000640    PIK46507.1    GBBI01004877    JAC13835.1    GDKW01001596    JAI54999.1    JARK01001362    EYC18844.1    EYC18843.1    GBGD01000453    JAC88436.1    JARK01001655    EYB84321.1    JARK01001396    EYC09581.1    JARK01000807    EYC34984.1    AAGJ04050748    JARK01001434    EYC02684.1    JARK01001367    EYC17351.1    JARK01000449    EYC36872.1    JARK01000224    EYC40226.1    JARK01001608    EYB86877.1    JARK01001414    JARK01001412    EYC06128.1    EYC06440.1    JARK01000347    EYC38051.1    JARK01001372    EYC15539.1    JARK01000460    EYC36749.1    JARK01001621    EYB86109.1    JARK01000189    EYC40935.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001340    EYC30828.1    JARK01000384    EYC37506.1    JARK01001626    EYB85833.1    EYC37503.1    EYC37504.1    JARK01001438    EYC02012.1    EYC37505.1    JARK01001343    EYC28635.1    JARK01001364    EYC18031.1    JARK01001348    EYC25257.1    PDUG01000004    PIC36796.1    JARK01001423    EYC04578.1    JARK01001344    EYC28218.1    QFQM01000478    PZR02946.1    JARK01001346    EYC26784.1    JARK01001361    EYC19034.1    JARK01001349    EYC24735.1    JARK01001341    EYC30223.1    JARK01001351    EYC23394.1    JARK01001365    EYC18009.1    JARK01001517    EYB93530.1    EYC18010.1    EYC25048.1    PDUG01000006    PIC20518.1    EYC31302.1    EYC25050.1    JARK01001378    EYC13977.1    JARK01001406    EYC07496.1    EYC25046.1    JARK01001630    EYB85641.1    JARK01000256    EYC39462.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    EYC25049.1    JARK01001470    JARK01000204    EYB98081.1    EYC40601.1    JARK01001475    EYB97550.1    JARK01001370    EYC16151.1    EYB98082.1    EYC40602.1    EYC30744.1    JARK01000063    EYC44387.1    EYC33297.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF13855   LRR_8
PF01826   TIL
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
Gene 3D

Ontologies

Topology

Length:
318
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03687
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.10424
outside
1  -  318
 
 

Population Genetic Test Statistics

Pi
1.545463
Theta
3.232162
Tajima's D
-1.327292
CLR
0
CSRT
0.0745462726863657
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号