SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14202
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 0.978
 

Sequence

CDS
ATGAACACGATCAAACAATTTTGCAGTGATGCAGGTTCAGCTCTGTTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGAGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTAGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCTCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTTCGCTGACCACGGATCCGGCTGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCATCTGATCACTGCCTTATTTGTGCTGCCGTACCACTCTCTCGTCCTGGTCGTCGAACGACGACCGGGTATCGAAGAGTTTGCCGGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGTCGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGAGGCATGGGATAATGCCGGGAGACGTCGGGATCCTAACATCTCAGGGGAAAGACGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCAGAGCACGTTGCTAGAGTTGGCGAGCCATTAAAGAGCTATTCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTTTGCAGTGACCGACAGTGCGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACACGTGGGCTGAAGCCCTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGGTAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATATCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGGCATGTTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGCATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCCGAATGGGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAATTCCGGCCTCGCATGGAGTACTGCTCCCCTCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAACCCCATCACGGTGCTTCCCGAGCGCTTTGACATGTCCTTCTTCAAACGAGGCTGTGGAGAGTATTAA
Protein
MNTIKQFCSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLRSRTTDLPGRTAYDFALAYGFSQLVTQPTRVSDIEGHEPSLLDLSLTTDPAGYSVVVDAPLGSSDHCLICAAVPLSRPGRRTTTGYRRVCRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKVVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYEAWDNAGRRRDPNISGERRKYNAASRSYKKVIAKAKSEHVARVGEPLKSYSSGSRAFWSLAKAAEGNFCSDRQCGFRHGRSAGDLLVYLTHTWAEALESKGEALAVSLDIGKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDIMTINAGVPQGSVLSPTLFILYINGMLSIDGMHCYADDSTGHARYIGHQSLSRSVVQERRSKLVSEVENSPNGDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQFRPRMEYCSPLWAGAPKYQLLPFDSIQRRAVRIVDNPITVLPERFDMSFFKRGCGEY

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
575
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13639
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.00376
outside
1  -  575
 
 

Population Genetic Test Statistics

Pi
1.458391
Theta
2.104435
Tajima's D
-1.085812
CLR
11.167258
CSRT
0.118094095295235
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号