SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14201
Pre Gene Modal
BGIBMGA011140
Annotation
PREDICTED:_fatty_acyl-CoA_reductase_1-like_[Bombyx_mori]
Full name
Fatty acyl-CoA reductase      
Location in the cell
PlasmaMembrane   Reliability : 3.212
 

Sequence

CDS
ATGGACAGCGCTTTGGCTTTGGAAATCGAGCAGGTCTCGCGTCAGAAGGCGCTGGAGGAGGAAGCGCTTCGCGGCGAGTCGGCTGTGCGGCAGTTCTACGCGGGAACCACAGCGCTGATCACTGGAGGCACGGGCTTCATCGGGAAACAACTCATAGAGAAACTTCTAAGATCGTGCGATGTTAAGCGGATTTACATATTGATACGATCGAAAAAGGGACTGTCTATGGAAGAAAGACTCCAGTTACAATTTAAAGATCCTGTATACGACAATTTACGGTCTCAACAACCAGATTTTGCTCGGAAAGTGATACCGGTCGAAGGCGACATCTCAGAACTAGGCGTCGGCCTGAACGATGAAGACAGGATGAAGCTTGCGCAAGAGGCGAATGTGATATTCCACGTGGCCGCCACGACCAGGTTCGAAGAGCCACTAAAGAAGGCCACATTCATTAACGTCAGAGGAACCAGGGAGATCATGGAATTGGCCAAATGCTGCAAAAATCTAAGATCCTTCGTACACGTGTCAACTGCGTTCTTCAATGCAACTAAGAGCAGAATAAATCACACCATCGAGGAGAAATTCTATGAAAGCCCTGTCCCTCCGGAAGTCATGATACAACTCGCGGAGACAGTTGAAGAATGCAGACTCAACGCGATCACTGCTGATTTGATAAGGGACTGGCCCAACACGTACTGCTTCACGAAGGCCATAGCGGAGGATGTCGTGCGTACAATGGGCAAGGCTTTACCTGTGGCCATATTTAACACCGGACCTCTATGTGCCGATCGAAGCAATCCATTATATTTTCCGTTTTCAGTTGCCTGCACGCTCAATGAACCCACACCTGGATGGCTGGATATGAGCTCGGTGATCGGTCCCAGCGGGATTCTTTTAACCGCAGGCCTTGGCGTGACGCATGTGGTTTTAATAGGTGACATAACGATAGCGCTAGCTCCTGTGGACTACGTCAACAACACTGTATTGGCGACAGCGTGGGAAACCGACAAACGTTTTAAAACTAATGAAAAAGAGTCTAAGATTTACAATATAAGCAACTCCAGATGCACACTTGAGAAAAATCTTTTGTGCGATGTCCTGCATCATCCTAACACAAAACAGTACGCTACGCCGAAAGCCGTTTGGTACTGTTATGGTTTTGAGACCGGAAGCGATGTTGTATTCTGGTTGTCAACGTGGCTGCTGCATTACATACCTGCGTATGTAGCCGACTTCGTGTTTAATGTGACCTCCATGAAGCGACCTGAAGGCATAAAGTCATTCGTTAAAATGTATGAAAAGATATACAAAATGTCTTTGTTGTACGGCTATTTCCTGAGGAACCAGTGGAATTTTGTCGATGACAACACCGTGGCCATGTTGAACCAAATGTCAAAAACTGACAGGATATTGTTCAATTTTGACATTTCGAAGATCGATTGGCCGCGCTATATGCTGATCTGGTGCATCGGCTTGAGAAAGTTCATCGTGAAAGACGGACTCAAAGACAGCGAGTATGGAATGAAGAAACAGAGATGGCTGAAGATAGCTCACATTAGTTTTTATACGCTGTTCTTTGGAGTCGTATTTTCTTTGTTATATCTCGCCTGTAGAATTTTTATGTCTGTAATTTGA
Protein
MDSALALEIEQVSRQKALEEEALRGESAVRQFYAGTTALITGGTGFIGKQLIEKLLRSCDVKRIYILIRSKKGLSMEERLQLQFKDPVYDNLRSQQPDFARKVIPVEGDISELGVGLNDEDRMKLAQEANVIFHVAATTRFEEPLKKATFINVRGTREIMELAKCCKNLRSFVHVSTAFFNATKSRINHTIEEKFYESPVPPEVMIQLAETVEECRLNAITADLIRDWPNTYCFTKAIAEDVVRTMGKALPVAIFNTGPLCADRSNPLYFPFSVACTLNEPTPGWLDMSSVIGPSGILLTAGLGVTHVVLIGDITIALAPVDYVNNTVLATAWETDKRFKTNEKESKIYNISNSRCTLEKNLLCDVLHHPNTKQYATPKAVWYCYGFETGSDVVFWLSTWLLHYIPAYVADFVFNVTSMKRPEGIKSFVKMYEKIYKMSLLYGYFLRNQWNFVDDNTVAMLNQMSKTDRILFNFDISKIDWPRYMLIWCIGLRKFIVKDGLKDSEYGMKKQRWLKIAHISFYTLFFGVVFSLLYLACRIFMSVI

Summary

Description
Catalyzes the reduction of fatty acyl-CoA to fatty alcohols.
Catalytic Activity
a long-chain fatty acyl-CoA + 2 H(+) + 2 NADPH = a long-chain primary fatty alcohol + CoA + 2 NADP(+)
Similarity
Belongs to the fatty acyl-CoA reductase family.
Feature
chain  Fatty acyl-CoA reductase
EC Number
1.2.1.84
EMBL
BABH01042202    BABH01042203    BABH01042204    BABH01035129    BABH01035130    BABH01035131    + More
BABH01035132    NWSH01000368    PCG76936.1    MF687542    ATJ44468.1    KZ150147    PZC72871.1    NWSH01000263    PCG77899.1    KZ149959    PZC76396.1    KZ150217    PZC72127.1    ODYU01004617    SOQ44684.1    PZC76395.1    PZC72129.1    KT261699    ALJ30239.1    PCG76937.1    NWSH01003107    PCG66934.1    PZC72126.1    AGBW02013183    OWR43905.1    KQ460036    KPJ18429.1    ODYU01010853    SOQ56210.1    KQ459593    KPI96441.1    KPI96440.1    KQ460890    KPJ10851.1    KPI96679.1    PZC72128.1    PCG77898.1    PCG76935.1    NWSH01000230    PCG78176.1    NWSH01001490    PCG71095.1    KT261695    ALJ30235.1    KU755476    ARD71186.1    BABH01035163    BABH01035164    PZC72130.1    KP237913    MF687534    AKD01766.1    ATJ44460.1    KP237926    MF687596    AKD01779.1    ATJ44522.1    KJ622061    AID66649.1    AGBW02011118    OWR47192.1    KPI96442.1    KPI96403.1    KK852740    KDR17399.1    GBHO01025676    JAG17928.1    KB632003    ERL87876.1    APGK01044237    APGK01044238    KB741021    ENN75098.1    NEVH01002545    PNF42309.1    GEDC01021312    JAS15986.1    GEDC01010770    JAS26528.1    NNAY01001641    OXU23345.1    GDHC01012276    JAQ06353.1    KJ622062    AID66650.1    GU808251    ADI82775.1    CVRI01000065    CRL05837.1    KPJ18430.1    GBYB01002483    JAG72250.1    AJWK01024997    AJWK01024998    AJWK01024999    KQ435694    KOX80980.1    GEBQ01030984    JAT08993.1    GECU01024246    JAS83460.1    UFQS01001285    UFQT01001285    SSX10116.1    SSX29838.1    MG573167    AWJ25029.1    NEVH01011924    PNF31087.1    MG573160    AWJ25022.1    GGMS01011572    MBY80775.1    GECU01016929    JAS90777.1    KQ976417    KYM89582.1    KU755485    ARD71195.1    GBHO01038325    GBHO01038321    GBRD01012464    GDHC01011251    JAG05279.1    JAG05283.1    JAG53360.1    JAQ07378.1    GECZ01027740    JAS42029.1    GEBQ01025216    JAT14761.1    KQ460152    KPJ17348.1    GFXV01002241    MBW14046.1    GGMS01010440    MBY79643.1    KT261704    ALJ30244.1    ABLF02017921    PCG77902.1    GFXV01007576    MBW19381.1    PZC76399.1    GEZM01061226    JAV70627.1    KQ971357    EFA08474.2    ACPB03001017    GEDC01000976    JAS36322.1    KQ776822    OAD52165.1    KP237938    MF687591    AKD01791.1    ATJ44517.1    GGMR01018223    MBY30842.1    KQ976870    KYN07801.1    KU963289    ANN23959.1    REGN01004851    RNA15897.1    ABLF02017029    CVRI01000054    CRL00357.1    KQ982194    KYQ59115.1    ABLF02012968    ADTU01015701    ADTU01015702    GFXV01004402    MBW16207.1    JRES01001250    KNC24227.1   
Pfam
PF03015   Sterile        + More
PF07993   NAD_binding_4
Interpro
IPR036291   NAD(P)-bd_dom_sf        + More
IPR013120   Male_sterile_NAD-bd       
IPR033640   FAR_C       
IPR026055   FAR       
SUPFAM
SSF51735   SSF51735       
PDB
4W4T     E-value=2.6968e-09,     Score=150

Ontologies

Topology

Length:
544
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
44.5435
Exp number, first 60 AAs:
1.01303
Total prob of N-in:
0.09358
outside
1  -  517
TMhelix
518  -  540
inside
541  -  544
 
 

Population Genetic Test Statistics

Pi
10.049372
Theta
14.026036
Tajima's D
-1.600398
CLR
0.974017
CSRT
0.0474976251187441
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号