SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14197
Pre Gene Modal
BGIBMGA011140
Annotation
PREDICTED:_fatty_acyl-CoA_reductase_1-like_[Bombyx_mori]
Full name
Fatty acyl-CoA reductase      
Location in the cell
PlasmaMembrane   Reliability : 3.085
 

Sequence

CDS
ATGGACAGCGCTTTGGCTTTGGAGATCGAGCAGGTCTCGCGCCAGAAGGCGCTGGAGGAGGAAGCGCTCCGCGGCGAGTCGGCTGTGCGGCAGTTCTACGCGGGAACCACAGCGCTGATCACTGGAGGGACGGGCTTCATCGGGAAACAACTCATAGAGAAGCTTCTAAGATCGTGCGACGTTAAGCGGATTTACATATTGGCACGATCGAAAAAGGGACTGTCTATGGAAGAAAGGCTCCAGTTACAATTTAAAGATCCTGTATACGACAATTTACGGTCTCAACAACCAGATTTCGCTCAGAAAGTGATACCGGTCGAAGGTGACATCTCAGAACTAGGCGTCGGCTTGAACGACGAAGACAGGATGAAGCTTGAGCAAGAGGTGAATGTGATATTCCACGTGGCCGCCACGACCAGGTTCGTAGAGCCACTGAAGAAGGCCACATTCATCAACGTCAGAGGAACCAGAGAGATCCTTGAACTGGCCAAATGCTGTAAAAATCTAAGATGCTTCGTACACGTATCAACTGCGTTCTTCAATGCAACAAAGAGCAAAATAAATCACACCATCGAGGAGAAATTCTATGAAAGCCCTGTCCCTCCGGAAGTCATGATACAACTCGCGGAGACAGTTGAAGAATGCAGACTCAACGCGATCACTGCTGATTTGATAAGGGACTGGCCCAACACGTACTGCTTCACGAAGGCCATAGCCGAGGATGTCGTGCGTACAATGGGCAAGGATTTACCTGTGGCCATAGTGAGGCCACCCATAGTTATCTGCACGCTCAATGAACCCACACCTGGATGGGTGGATATAAGCTCAGTGTTCGGTCCCAGCGGGATTCTTTTAGGCATAGGCCTTGGCGTGACGCATGTGGTTTTAATAGGTGACATAACGATAGCGCTAGCTCCTGTGGACTACGTCAACAACACTGTATTGGCGACAGCGTGGGAAACCGATAAACGTTTTAAAAATAATGAAAAAGACTCTAAGATTTACAATATAAGCAACTCCAGATGCACACTTGAGAAAAATCTCGTGGGTGATCTCCTGCAGAATCCTAACACACAACAGTACGCTACGCCGAAAGCGGTTTGGTACTGTTATGGTTTTGAGACCGGAAGCGATGTTGTATTCTGGTTGTCAACGTGGCTGCTGCATTACATACCTGCGTATGTAGCCGACTTCGTGTTTAATGTGACCTCCATGAAGCGACCTGAGGGTATTAAGTCATTCGTTAAAATGTATGAAAAGATATACAAAATGTCTTTGTTGTACGGCTATTTCCTGAGGAACCAGTGGAATCTTGTCGATGACAACACCGTGGCCATGCTGAACCAAATGTCAAAAACTGACAGGATATTGTTCAATTTTGACATTTCGAAGATCGATTGGCCGCGCTATATGCTGATCTGGTGCATCGGCTTGAGAAAGTTCATCGTGAAAGACGGACTCAAAGACAGCGAGTATGGAATGAAGAAACAGAGATGGCTGAAGATAGCTCACATTAGTTTTTATACGCTGTTCTTTGGAGTCGTATTTTCTTTGTTATATCTCGCCTGTAGAATTTTTATGTACTTATGTAATTTGAATACGATCGCCGCTCAAACACTTAAAATATAA
Protein
MDSALALEIEQVSRQKALEEEALRGESAVRQFYAGTTALITGGTGFIGKQLIEKLLRSCDVKRIYILARSKKGLSMEERLQLQFKDPVYDNLRSQQPDFAQKVIPVEGDISELGVGLNDEDRMKLEQEVNVIFHVAATTRFVEPLKKATFINVRGTREILELAKCCKNLRCFVHVSTAFFNATKSKINHTIEEKFYESPVPPEVMIQLAETVEECRLNAITADLIRDWPNTYCFTKAIAEDVVRTMGKDLPVAIVRPPIVICTLNEPTPGWVDISSVFGPSGILLGIGLGVTHVVLIGDITIALAPVDYVNNTVLATAWETDKRFKNNEKDSKIYNISNSRCTLEKNLVGDLLQNPNTQQYATPKAVWYCYGFETGSDVVFWLSTWLLHYIPAYVADFVFNVTSMKRPEGIKSFVKMYEKIYKMSLLYGYFLRNQWNLVDDNTVAMLNQMSKTDRILFNFDISKIDWPRYMLIWCIGLRKFIVKDGLKDSEYGMKKQRWLKIAHISFYTLFFGVVFSLLYLACRIFMYLCNLNTIAAQTLKI

Summary

Description
Catalyzes the reduction of fatty acyl-CoA to fatty alcohols.
Catalytic Activity
a long-chain fatty acyl-CoA + 2 H(+) + 2 NADPH = a long-chain primary fatty alcohol + CoA + 2 NADP(+)
Similarity
Belongs to the fatty acyl-CoA reductase family.
Feature
chain  Fatty acyl-CoA reductase
EC Number
1.2.1.84
EMBL
BABH01042202    BABH01042203    BABH01042204    BABH01035129    BABH01035130    BABH01035131    + More
BABH01035132    NWSH01000368    PCG76936.1    NWSH01000263    PCG77899.1    KZ149959    PZC76396.1    MF687542    ATJ44468.1    KZ150147    PZC72871.1    ODYU01004617    SOQ44684.1    KZ150217    PZC72129.1    PZC76395.1    PZC72127.1    KT261699    ALJ30239.1    PCG76937.1    KQ460036    KPJ18429.1    NWSH01003107    PCG66934.1    PZC72126.1    AGBW02013183    OWR43905.1    ODYU01010853    SOQ56210.1    KQ459593    KPI96441.1    KPI96679.1    KPI96440.1    KQ460890    KPJ10851.1    PZC72128.1    PCG77898.1    PCG76935.1    NWSH01000230    PCG78176.1    NWSH01001490    PCG71095.1    KT261695    ALJ30235.1    KU755476    ARD71186.1    BABH01035163    BABH01035164    AGBW02011118    OWR47192.1    PZC72130.1    KP237913    MF687534    AKD01766.1    ATJ44460.1    KP237926    MF687596    AKD01779.1    ATJ44522.1    KJ622061    AID66649.1    KPI96403.1    KK852740    KDR17399.1    KPI96442.1    KJ622062    AID66650.1    NEVH01002545    PNF42309.1    KB632003    ERL87876.1    NNAY01001641    OXU23345.1    APGK01044237    APGK01044238    KB741021    ENN75098.1    GU808251    ADI82775.1    KPJ18430.1    GBYB01002483    JAG72250.1    GDHC01012276    JAQ06353.1    GBHO01025676    JAG17928.1    CVRI01000065    CRL05837.1    KU755485    ARD71195.1    GGMS01011572    MBY80775.1    KU963289    ANN23959.1    PCG77902.1    PZC76399.1    NEVH01011924    PNF31087.1    KQ976417    KYM89582.1    GFXV01007576    MBW19381.1    MG573160    AWJ25022.1    KP237938    MF687591    AKD01791.1    ATJ44517.1    KT261704    ALJ30244.1    KQ460152    KPJ17348.1    AJWK01024997    AJWK01024998    AJWK01024999    KQ971345    EFA05090.1    GGMS01010440    MBY79643.1    GEDC01010770    JAS26528.1    GEBQ01030984    JAT08993.1    GEDC01021312    JAS15986.1    GECU01024246    JAS83460.1    KQ976870    KYN07801.1    ABLF02017921    KQ982194    KYQ59115.1    UFQS01001285    UFQT01001285    SSX10116.1    SSX29838.1    KQ435694    KOX80980.1    GGMR01018223    MBY30842.1    GECU01016929    JAS90777.1    ADTU01015701    ADTU01015702    GECZ01027740    JAS42029.1    ABLF02012968    GEDC01000976    JAS36322.1    JRES01001250    KNC24227.1    GFXV01002241    MBW14046.1    ACPB03001017    KK853504    KDR07123.1    REGN01004851    RNA15897.1    GEZM01093770    JAV56139.1    EFA05024.1    GEBQ01025216    JAT14761.1    GL888353    EGI62240.1    CVRI01000054    CRL00357.1   
Pfam
PF03015   Sterile        + More
PF07993   NAD_binding_4
Interpro
IPR036291   NAD(P)-bd_dom_sf        + More
IPR013120   Male_sterile_NAD-bd       
IPR033640   FAR_C       
IPR026055   FAR       
SUPFAM
SSF51735   SSF51735       
PDB
4W4T     E-value=2.07191e-10,     Score=159

Ontologies

Topology

Length:
542
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
47.3686
Exp number, first 60 AAs:
1.53592
Total prob of N-in:
0.14370
outside
1  -  503
TMhelix
504  -  526
inside
527  -  542
 
 

Population Genetic Test Statistics

Pi
3.939364
Theta
16.745876
Tajima's D
-1.623655
CLR
0.077277
CSRT
0.0442977851107445
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号