SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14190
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.41
 

Sequence

CDS
ATGGCGCAAAACGCTAGAGAGAAACCATATTCCCTTACGTTAGCATTCTACAATGCTAACGGACTCGCGCGACAACGCGATCAAATTTACGAATTCCTCCGCGACAATCTTGTAGATATTCTGCTAGTGCAGGAGACCTGCCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACCCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTCTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCACAGTTCAAACATAAATGGTAGGCGTCTCGACGCGTTTATAGACGACCTTACCTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATTCACAGCTACGAGGACCATGGTGGACTGGAAGAAGCTGGGCAAATGCTTAGCCGATGCCGCTCCACCAATCCTCCCTGCGGCCCGGATTCAACTCCCTCCCCCGAGGACACAGTCGAATCCATAAACATCATCACGGATCACATCTCTTCCGCGATCATAAGATCCTCAAAAGAAGTCGATGTGGAGGATAGCTTCCACCGCATCAGACTGTCCCCCGAACTTAGGAACCTCCTAAGAGTTAGAAACGCGGCAATCCGGGCCTACGATCAACTTCCCACGCACTCAAACCGGATTCGGATGCGTCGTCTACAGCGGGATGTAAAATCTCGCCTAAGCGACGCCCGAAATGAGAATTGGGATAGTTACTTAGAAGGACTCGCGCCCTCTCATCAAGCATACTGGCGACTAGCAAGGACTCTCAAGTCCGAAACTACCGCTACTATGCCTCCTCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACCGAGGCAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCACCCTCGGACGCGTTACCCCCCATTACCTCTGACGAAGTTAGAGAAGTAATAGACAACCTTCAACCTAAGAAGGCACCCGGCTACGACGGCATCCGCAACCGCGCGTTAAAACTCTTACCAGTCCAACTGATAACAATGTTGGCTACCATCTTAAATGCTGCTATGACGCACTGCATCTTTCCGGCGGTATGGAAAGAAGCAGACGTTATCGGTATACACAAGCCGGGCAAACCGAATAATGAAACCGCTAGTTACCGACCGATTAGTCTCCTCCCAGCGATAGGCAAAATTTACGAACGGCTCCTTCGGAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTAATAGACGAGCAGTTTGGATTCCGCGCCAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCTTAATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATGTAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCATCTGACTGCCGGAGTCCCGCAAGGCTCCGCACTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGTTGCTTCATCGGCGACTCCAGACCGCAGTAACCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCCACGAAAAGCACAGCGGTGCTATTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCACCCCACTCCCCAGTAGGCGCGTAAACACCTCCGCCGTTAGCCCCATCACTCTCTTTGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCACGTAAAAACGGTACGCGATCGCGCCGCGTTTATACTAGGACGACTCTACCCAATGCTTTGTAGACGAAGCAAACTGTCCCTCCGTAACAAGGTAACCCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCGGCCCGCACCAACTTGAAACCCCTTCAGGTAATACAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCAGAGGAACGTGGACCTCCACGATGACCTGGAGCTCGACCCCGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCACTTTGAGAAGGCGGCACGACATGAGAACCCTCTTGTCGTGGCCGCCGGAAACTACATACCCGATCCTGTAGACCGTTTGCTAAACATCCGAAAAAGGCTCTCTTCCATCTGCCGGGAACGTGTTATGAGCTTCTTCGGACACATCATGCGGTCCGCCAGATATGAATTAGAGAAGCTCATAATTGCGGGTCGCATAGAGGGCAAGCGCGCCGTGGGCAGAACACCAGCCAGATAG
Protein
MAQNAREKPYSLTLAFYNANGLARQRDQIYEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHSSNINGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAIHSYEDHGGLEEAGQMLSRCRSTNPPCGPDSTPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPELRNLLRVRNAAIRAYDQLPTHSNRIRMRRLQRDVKSRLSDARNENWDSYLEGLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQYADPEHTEAVDREVERRASLPPSDALPPITSDEVREVIDNLQPKKAPGYDGIRNRALKLLPVQLITMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPNNETASYRPISLLPAIGKIYERLLRKRLWDFVTANKILIDEQFGFRAKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDVAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRHLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQTAVTTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSTPLPSRRVNTSAVSPITLFDQPIPWAPKVKYLGVTLDRGMTFRPHVKTVRDRAAFILGRLYPMLCRRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFQRNVDLHDDLELDPVSKYLQSASLRHFEKAARHENPLVVAAGNYIPDPVDRLLNIRKRLSSICRERVMSFFGHIMRSARYELEKLIIAGRIEGKRAVGRTPAR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    RPOV01000134    RPJ78669.1    GBBI01004571    JAC14141.1    KQ973412    EFA12510.2    S59870    AAB26437.2    GGMR01018716    MBY31335.1    ABLF02042518    ABLF02057746    GGMS01002992    MBY72195.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    GGMS01006359    MBY75562.1    ABLF02008153    ABLF02008462    ABLF02008464    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    KK119692    KFM76444.1    GFTR01008038    JAW08388.1    NEVH01006736    PNF36716.1    GGFJ01001858    MBW50999.1    GGMR01003407    MBY16026.1    GGFJ01001857    MBW50998.1    NEVH01021205    PNF19912.1    GFTR01008271    JAW08155.1    GFTR01008279    JAW08147.1    GGMR01000676    MBY13295.1    NEVH01011985    PNF31054.1    GFTR01008261    JAW08165.1    GFTR01008256    JAW08170.1    NEVH01027074    PNF13841.1    GFTR01008251    JAW08175.1    NEVH01009134    PNF33528.1    GGMR01012305    MBY24924.1    GFTR01008262    JAW08164.1    GBGD01000415    JAC88474.1    NEVH01016302    PNF25823.1    ABLF02022418    GFXV01000908    MBW12713.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02034467    GFTR01008269    JAW08157.1    ABLF02023911    NEVH01017470    PNF24199.1    ABLF02024246    GGMS01017365    MBY86568.1    GGFJ01001822    MBW50963.1    GGMR01006408    MBY19027.1    NEVH01020940    PNF20481.1    GFXV01002840    MBW14645.1    GGFL01005122    MBW69300.1    GGMR01016296    MBY28915.1    GGFL01005121    MBW69299.1    GFTR01008151    JAW08275.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008260    JAW08166.1    GGMR01012283    MBY24902.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGFJ01002256    MBW51397.1    GGMR01016905    MBY29524.1    GGFJ01002257    MBW51398.1    GEZM01053022    JAV74219.1    NEVH01026386    PNF14434.1    M22874    M38643    NWSH01007753    PCG62823.1    GFTR01008254    JAW08172.1    GBGD01000389    JAC88500.1    GGMR01003864    MBY16483.1    AY060438    AAL25477.1    X17551    CAA35587.1    GFTR01008257    JAW08169.1    GGMR01013409    MBY26028.1    GEZM01084969    JAV60363.1    KU543673    AMS38352.1    DNOY01000259    HBE18313.1    AY508487    AAS13459.1    M38437    NEVH01005295    PNF38784.1    AY047531    AAK77263.1    GGMR01000226    MBY12845.1    ABLF02040174    ABLF02040183    ABLF02055266    GBHO01008295    JAG35309.1    GGMR01012443    MBY25062.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0174653,     Score=93

Ontologies

Topology

Length:
945
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.372630000000001
Exp number, first 60 AAs:
0.00127
Total prob of N-in:
0.00978
outside
1  -  945
 
 

Population Genetic Test Statistics

Pi
1.841369
Theta
14.318719
Tajima's D
0
CLR
22.911
CSRT
0.378331083445828
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号