SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14157  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA011180
Annotation
nonclathrin_coat_protein_gamma2-COP_[Bombyx_mori]
Full name
Coatomer subunit gamma       + More
Nipped-B protein      
Alternative Name
Gamma-coat protein
Location in the cell
Golgi   Reliability : 2.794
 

Sequence

CDS
ATGAGCTCTCTCAAGCGAGATGTTAAGGATGAAGATGATAACAGCAGTAACCCATACCAGAATCTCGATAAAACTATAGTACTTCAAGAAACACGAGAGTTTAATCAAACGCTCGTTATCCCGAGAAAATGTTCATTAATACTTACGAAAATACTGTATTTACTGAATCAAGGCGAAAATTTCACCACTCAGGAGGCTACGGACGCTTTCTTTGCGACAACAAAACTGTTTCAGTCCAAAGAAATCATGCTGCGACGTATGGTTTATCTTTGCATCAAAGAACTGAGTAAATTGGCGCAAGATGTGATCATAGTGACTTCCTCTTTGACTAAAGACATGACCGGTAAAGAGGATCTGTACCGGGCGGCCGCAATAAGAGCGTTGTGCAGCATCACGGACGCCTCTATGCTACAAGCTATCGAACGATATATGAAACAGGCGATTGTGGACAAGAACCCGGCCGTCAGTTCTGCGGCATTAGTCTCTGCGCTTCATTTGTCTTCTACCGCACCGGATCTTGTTCGGCGATGGGCTAATGAAGCTCAGGAAACAATCAATTCGGACAATGCGATGGTGTCGTATCACGCATTGGGTGTTCTGGTATTATCGCGTCGAAATGATAAGTTATCTACAGTTAAACTGGTGACACGACTTTCTAAGTCCCACATAAAATCACCATACTCCCTCTGCTTGCTTATACGTTTAGCTGCTCAGCTATGTGACGGTGATGATTCTGAAGCATCTCAACCTTACATAGACTTTATAGAGTGCTGCTTACGTCATAAATCTGAAATGGTTATCTATGAGGCGGCCCATGCAATCGTCAACTTGAGAAAGACCGCCCGGGATCTTGCTCCGGCAGTATCAGTTTTGCAATTGTTCTGCAGCTCTTCGAAGGCGGCTCTCAGATTGGCTGGAGCCAGGACTTTGGCCCGGTTGACGACAGAACACCCTACAGCAGTCGCTGCATGCGCTATTGACTTGGAAAACTTAATCTCAGATTCTAATCGGTCCGTGGCGACCTTAGCTGTAACAACGCTATTAGCGACAGGCGCAGAAAGTTCCGTGGACAGGCTGATGAAGCAGATTTCGAGCTTTGTATCGGAAATTCCAGATGAGTTCAAAATAATCGTCGTCAGAGCCATCAGGCAGCTGTGCAGCAAGTTCCCGAGGAAGCATCAGTCGCTGGCTGCATTCTTAGCCGGAATGTTGAGAGACGAAGGTGGCCTGGAATACAAAGCAGCTATAGCCGACGCGATTATAGCTTTGGTCGAAGAAAATCCTGACGCTAAAGAAACAGGACTGTCTCATTTATGCGAGTTCATTGAAGATTGCGAGCACACGGCATTGGCAGTTCGTATACTGCATCTGTTGGGACGAGAAGGTCCTAAGTCTCGTCACCCGTCAAGATATATAAGATTCATTTACAATAGAGTTATTTTGGAGTCCGGCCCGGTCAGAGCCGCGGCAGTTTCCGCCGTAGCACAGTTCGGAGCACAAGTACCGGAACTATTGCCAAATATCAAGGTGTTATTGGCTCGCTGTCAGTTAGACGAAGAAGATGAAGTCAGAGATAGAGCAGTATATTACAGTACGATACTAGAGACCGAGAACCCTCAGCTCATCAATGATTTCATTGTTAATATACCGAAACCGAATGTGGTGTTGCTAGAAAAGGCCTTGAGAGATCATTTGTTGCACCCCGAAGAACCGTTTAATATTTTGTCCGTTCCGGCCGAGGAGGTGGTCAAGGAAACTAAAAAGCCTATAGTCGAAATCGAAGTTCGCAAACCGGTGCAAATGTCTATCGAAGAGATCTACGCTGAGCAGTTGGCTAAAATACCGGGCATCGAGAAATTAGGGCCGTTGTTCAAAACGAATTTGCCAATAGATCTGACCGAAGCGGAGATCGAGTACCGGGTTCGCGTAGTGAAACACGTGTACGCACGCCACGTTATATTCCAATTCGAATGCGTGAACACGTTGAACGATCAAATACTAGAGGACGTCCACGTCCGATTGGAAGTTCCACCAGAATACGAAATCAAATCTATCGTTCCTTGTCAGAAGCTGGTCTACAACACACAGGACAACGTTTTCGTGGTCGTCGAATACCCTTGCGCGTTTATAGACAGTTTGGGTTCGTTTATGGCTACGTTGGAGTTCGTCGTGCGCGACTGCGACCCTAATACCGGAACTCCGGACCCTGGCGAGGGTTACGCCGACTCTTATCCCCTGGAAGAGTTCGAAATGGGTTGTTCTGACCAGATCAGGGCTAGGGCTGGGGGAGACGATTGGGAACAGACTTGGGAGAGAGCTGCGAACGTTCCAGAAGCTAATGACACGTTCGTGTTGTCGCAGACCGATGTCGGTGACGCTGCGAAGGCTGTTTGCGAGCATCTCGGCCTCCCGAACGGTTCGATAAGCGGTGATGCAGTTAAGGAGATCCGTGGTGGGGGTATATTTAGGGGCGGGGCGCCGGTTTTGGTTAGAGCTCGCTTAGCGGGTAGCAGTGCTGGCGTCACTATGAAGTTATCGGCCCGATCACCCCGGGAAGACGTAGCTCAACTACTCTTGGCGGCTGTGGGTTAA
Protein
MSSLKRDVKDEDDNSSNPYQNLDKTIVLQETREFNQTLVIPRKCSLILTKILYLLNQGENFTTQEATDAFFATTKLFQSKEIMLRRMVYLCIKELSKLAQDVIIVTSSLTKDMTGKEDLYRAAAIRALCSITDASMLQAIERYMKQAIVDKNPAVSSAALVSALHLSSTAPDLVRRWANEAQETINSDNAMVSYHALGVLVLSRRNDKLSTVKLVTRLSKSHIKSPYSLCLLIRLAAQLCDGDDSEASQPYIDFIECCLRHKSEMVIYEAAHAIVNLRKTARDLAPAVSVLQLFCSSSKAALRLAGARTLARLTTEHPTAVAACAIDLENLISDSNRSVATLAVTTLLATGAESSVDRLMKQISSFVSEIPDEFKIIVVRAIRQLCSKFPRKHQSLAAFLAGMLRDEGGLEYKAAIADAIIALVEENPDAKETGLSHLCEFIEDCEHTALAVRILHLLGREGPKSRHPSRYIRFIYNRVILESGPVRAAAVSAVAQFGAQVPELLPNIKVLLARCQLDEEDEVRDRAVYYSTILETENPQLINDFIVNIPKPNVVLLEKALRDHLLHPEEPFNILSVPAEEVVKETKKPIVEIEVRKPVQMSIEEIYAEQLAKIPGIEKLGPLFKTNLPIDLTEAEIEYRVRVVKHVYARHVIFQFECVNTLNDQILEDVHVRLEVPPEYEIKSIVPCQKLVYNTQDNVFVVVEYPCAFIDSLGSFMATLEFVVRDCDPNTGTPDPGEGYADSYPLEEFEMGCSDQIRARAGGDDWEQTWERAANVPEANDTFVLSQTDVGDAAKAVCEHLGLPNGSISGDAVKEIRGGGIFRGGAPVLVRARLAGSSAGVTMKLSARSPREDVAQLLLAAVG

Summary

Description
The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins.
The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Required for limiting lipid storage in lipid droplets. Involved in the expansion of luminal extracellular matrices and apical membrane during tubulogenesis. Required in the tracheal epithelium for luminal protein secretion and diametric tube growth. In salivary glands, required for deposition of O-glycans and luminal extracellular matrix assembly. Required for epidermal morphogenesis and cuticle development.
The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Required for limiting lipid storage in lipid droplets. Involved in the expansion of luminal extracellular matrices and apical membrane during tubulogenesis. Required in the tracheal epithelium for luminal protein secretion and diametric tube growth. In salivary glands, required for deposition of O-glycans and luminal extracellular matrix assembly. Required for epidermal morphogenesis and cuticle development (By similarity).
Subunit
Oligomeric complex.
Oligomeric complex that consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits.
Similarity
Belongs to the COPG family.
Belongs to the SCC2/Nipped-B family.
Keywords
Alternative splicing   Complete proteome   Cytoplasm   Cytoplasmic vesicle   Endoplasmic reticulum   ER-Golgi transport   Golgi apparatus   Membrane   Protein transport   Reference proteome   Repeat   Transport  
Feature
chain  Coatomer subunit gamma
splice variant  In isoform A and isoform C.
EMBL
BABH01010017    AB040670    BAA93048.2    KZ150337    PZC71320.1    NWSH01000384    + More
PCG76795.1    ODYU01008925    SOQ52929.1    RSAL01000005    RVE54419.1    GDQN01008422    JAT82632.1    JTDY01001569    KOB73496.1    KQ459593    KPI96430.1    KQ460036    KPJ18403.1    AGBW02009564    OWR50469.1    ODYU01005182    SOQ45790.1    AB040669    BAA93047.2    AGBW02009108    OWR51662.1    GAIX01004842    JAA87718.1    NWSH01000574    PCG75562.1    GDQN01007176    JAT83878.1    RSAL01000174    RVE45059.1    BABH01007296    JTDY01009845    KOB62497.1    KQ461196    KPJ06373.1    KQ971372    EFA09678.1    GFDF01003529    JAV10555.1    GEZM01094084    JAV55944.1    AF191563    AE014297    AY113545    BT001628    AAF05719.1    AAN14275.1    AAN71383.1    KK852470    KDR23235.1    AGB96524.1    CH480846    EDW50955.1    CM000070    EAL27405.1    CH902623    EDV30386.1    CM000160    EDW99229.2    NEVH01009087    PNF33659.1    CH954182    EDV52947.1    BT132667    AEQ05569.1    GAKP01020481    GAKP01020480    JAC38471.1    JXJN01007759    KPU72823.1    JRES01001712    KNC20586.1    CH916369    EDV92780.1    GDHF01016028    JAI36286.1    GBXI01014417    JAC99874.1    OUUW01000005    SPP80522.1    KRK04737.1    UFQS01002986    UFQT01002986    SSX15016.1    SSX34402.1    CH940650    EDW67417.2    GANO01000740    JAB59131.1    CH964232    EDW80788.1    GDAI01000316    JAI17287.1    UFQS01003479    UFQT01003479    SSX15677.1    SSX35036.1    CH933806    EDW14326.1    DS235271    EEB14189.1    KA647821    AFP62450.1    GGFM01001094    MBW21845.1    GGFM01001080    MBW21831.1    GGFM01001092    MBW21843.1    SPP80523.1    CP012526    ALC45581.1    GGFK01001201    MBW34522.1    GGFJ01001859    MBW51000.1    ADMH02000176    ETN67504.1    GDIP01043181    LRGB01003216    JAM60534.1    KZS03726.1    JXUM01074479    JXUM01074480    KQ562832    KXJ75044.1    GBXI01012296    JAD01996.1    KQ459605    KPI91926.1    GDUN01001107    JAN94812.1    GAMC01019354    GAMC01019353    JAB87201.1    CCAG010001934    GFDL01000768    JAV34277.1    GDIQ01060939    JAN33798.1    GDIQ01177398    GDIQ01062788    JAN31949.1    AXCM01001007    GDIQ01022262    JAN72475.1    AAAB01008984    CVRI01000066    CRL05888.1    GAPW01000182    JAC13416.1    JH431094    GBBM01000476    JAC34942.1    IAAA01008267    LAA03007.1    NNAY01000795    OXU26460.1    KK119796    KFM76767.1    GFPF01006825    MAA17971.1    GEDV01003741    JAP84816.1    GFPF01006824    MAA17970.1    GL452292    EFN77599.1    AXCN02000790   
Pfam
PF01602   Adaptin_N        + More
PF16381   Coatomer_g_Cpla
PF08752   COP-gamma_platf
PF12830   Nipped-B_C
PF12765   Cohesin_HEAT
PF00107   ADH_zinc_N
PF16884   ADH_N_2
Interpro
IPR013041   Clathrin_app_Ig-like_sf        + More
IPR002553   Clathrin/coatomer_adapt-like_N       
IPR037067   Coatomer_gsu_app_sf       
IPR009028   Coatomer/calthrin_app_sub_C       
IPR017106   Coatomer_gsu       
IPR011989   ARM-like       
IPR032154   Coatomer_g_Cpla       
IPR013040   Coatomer_gsu_app_Ig-like_dom       
IPR016024   ARM-type_fold       
IPR012295   TBP_dom_sf       
IPR026003   Cohesin_HEAT       
IPR024986   Nipped-B_C       
IPR033031   SCC2/Nipped-B       
IPR014190   PTGR1       
IPR036291   NAD(P)-bd_dom_sf       
IPR041694   ADH_N_2       
IPR011032   GroES-like_sf       
IPR013149   ADH_C       
SUPFAM
SSF49348   SSF49348        + More
SSF48371   SSF48371       
SSF55711   SSF55711       
SSF50129   SSF50129       
SSF51735   SSF51735       
Gene 3D
PDB
5NZV     E-value=0,     Score=2015

Ontologies

Topology

Subcellular location
Cytoplasm  
Golgi apparatus membrane  
Cytoplasmic vesicle  
COPI-coated vesicle membrane  
Endoplasmic reticulum   The coatomer is cytoplasmic or polymerized on the cytoplasmic side of the Golgi, as well as on the vesicles/buds originating from it.   With evidence from 1 publications.
Nucleus  
Length:
863
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.048
Exp number, first 60 AAs:
0.00428
Total prob of N-in:
0.00221
outside
1  -  863
 
 

Population Genetic Test Statistics

Pi
15.288518
Theta
13.583737
Tajima's D
0.577613
CLR
0.881021
CSRT
0.549472526373681
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 AICSITDASMIQAIER 95.65 4e-08
26822097 EFNQTIVIPR 100.00 7e-04
26280517 AGEIEKEIEK 100.00 7e-04
27102218 ETGISHICEFIEDCEHTAIAVR 100.00 7e-04
26822097 IAQDVIIVTSSITK 100.00 0.019
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号