SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14127
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.2
 

Sequence

CDS
ATGGATGTGGCCTGGACTGAGGTGGTGAAGCGGGGCAATAAGAATAAAAAAAGGGTGCCGGCTGCGGCACGCCCCCAGCCCGCCCCAGCGGCTGCTGCTTCCCATCAAGAGGGTCGAGCGGCAGCTCAAGGAAAAAACAAGAGGCGTCGAAACGGCAAACCGCGCGCTCCGCGGTCAGCGGCAGTGGTCTTGGAGCTACTGCCGGCTGCAAAGGAAAAGGGCATTACCTATATGGAGGTAATGAGCCGAGCGCGTGGTGCCGTTGATGTCGACGCCATAGGCGTGGAGGGCGGGCTCAAGGTTCGGCACACCGCTAACGGGGCCCGGCTACTGGAATGTCCAGGCGCCCAATCTGGCGCAGCCGCGGACAGACTGGTGGCGCGGCTCCGGGAGATTTTGCCGGACCCAGAGATAGTGCGCATCGAACGCCCCGTCAAAATGGCGGAAGTCAAATTGACGGGCCTCGATGAATGCGCCACCCAGGACGAAGTGGCCGCCGCCATTGCATCACAGGGGAACTGTGCCCTGGCCCACGTTAAGGTGGGGGAACTCCGGAGCACTTACTCCGGAGCCCGCACCGCATGGGCGCGATGCCCCGTGCAGGCGGCCATTCTCCTAGCCACCTCCAAGTGGGAAGCCTGCCAACACGCCTGGAAGGCTGCGCGTAGGCTGGATCATGGCTCAGGTGCAACTACAGGAGGCAAGACCTTGGCGATGCCTCCGGCGCTTCGGTACTGGTCCGGGCACAAGGCTGCCACCTGCACCGCCGTTCCGCACTGTGTACTTTGTGATGCGGCGAAGCGGCAGGCCGACCACCGGGCTGGGGGGCCAGCATGTCGTTCAGCCCCCTCCTCAACGAAGAGGAGGAGAGGTGGAAAAAATAAAAGAAAAAAAGGTGCAGAGGAGGTGCCAGCTGCAAATGGAGTAGCAGGCGAGCTAGTTCCCGCCGCGGCTGTCGAGCCGGAGGGCGGGACGGGCGAAGGAGCGACGGACGCCAATCTGAACCACTCCGCCAGGGCGCAGGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATTGATGTTGCTGTCGCCGCGGAGCCGTACTTCGTCCCTGCTGATCAGGATTCCTGGATCGGGGACATCGACGGCTCCGTGGCAATCATAATCAGACAGGCTGCGGCGTTACCCCCCCTGGTGATGGTGGCCAGGGGATCCGGTTACGTCGCGGCCAGGGTCGATGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGACATCTCGCTGAGTTCGAGCGGTTCTTGGGCGGGTTCGAGGCGTTGGTTAATCGCCTCGGGTCTCGCCCGGTGATTTTAGCGGGAGACCTCAATGCCAAATGGGTAGCTTGGGGTTCCCCCCGCCCGAACTCGCGCGGCAGGATGCTCTCGGAGTGGGCGATCGCGGCCGGTCTCTGTCTCTTGAACAGGGGTTCGGTCGCGACTTGCGTGCGATGGAACGGCGAATCTCACGTGGATGTGACTTTCGCATCTCCTTCCATCGCACGCCGCACCCGTGGCTGGCGTGTCCTTGAAGGGGCGGAGACGCTCTCGGACCATCGATACGTCCGATTTGAGCTCTCTGCCTCCTCTCGCTCTGCGTCAGCTATGGTCGCCCGTGGTGAGGAGGAGCTCCCGCGTAGTACGCCTCGATCATTCCCCAGGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGGTGGAGGCGGCTGCAGTGGCTGCGTGGGCACCCGTGCCCGCGAGCCCTGTGGATGTGGAGTCGGAGGCTGACTGGTTCCGGGGAACGATGTGTCGGACTTGCGATGCAGCGATGCCCCGGGTAGGTGGCCACGCTCCGCGTGGCGGTGCGTACTGGTGGTCACCCAATATCGCGCAACTCCGGCATGCAGACGCTCCTGGAGACGCTCGATCAGGATCCCTGGGGGCGCCCATACAAAACTGTCCGCAAGAAATTGCGGCCGTGGGCTCCCCGATGACCGAGCGACTCCAGCCTCGGCAGCTGCGGGAAATAGTTTCTGCGCTGTTCCCGCAGGGAGAGGGGACTTTTCGGCCCCCTTTCATGGGCACGCCACCACATCACGATGGTGGTGATGCCCCTGCCGACGTGCCCTCTCCGAAGATTTCGGGGGCAGAGATCCGTGCGGCCGTGTCAAAGATGAGGAGGAAGGACGCGGCCCCCGGCCCTGATGGTATTCACGGCCGGGTCTGGGATTTGGTCTTCGGTGCTCTGGGGGACCGGCTTGTGCGACTTTTCGAAGCTTGCCTTGAGTCGGGACGGTTTCCGACCCAGTGGAAGACGGGCAAACTCGTCCTTTTGAGGAAGGAGGGGCGCCCGGCGGACTCACCCGCGGGTTACCGCCCCATTGTGTTGCTGGACGAGGCGGGAAAATTGTTGGAGCGAGTCGTCGCCGCCCGCATCGTCCGGCACCTGACTGGGACGGGTCCCGATCTATCGGCGGAGCAGTACGGCTTCAGAGAGGGCAGCTCTACCATCGACGCGATTATGCGCGTGCGTGCCCTCTCTGATGAAGCTGTCGCCCGGGGTGGGGTGGCTCTGGCAGTGTCCCTGGACATTGCCAATGCTTTCAACACCTTACCCTGGTCAGTGATCGCGGGGGCGCTTGAATATCACTGCGTCCCTGCGTACCTCCGCCGGCTGATCGGATCCTATCTTGAGGACAGGTCGGTCGTATGCACCGGACACGGGGGTGCGGTGCTCCGCTTTCCGGTCGAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTTCTGTGGAATATCGGCTACGACTGGGTCCTGCGGGGTGCCCTTCACAGCCCTCTCCCGGGCCTACGCGTTGTGTGTTACGCGGATGACACGTTAGTCATGGCTCGGGGGAAAGACTACCATGAGTCTGCCCGTCTTGCCTGCGCAGGGGTGGCATTCGTCGTCGGTAATATTCGGAGGTTGGGCCTCGAGGTGGCGCTCGAAAAATCCCAGGCCCTGCTGTTTCACAGGGCTGGAAGAGAGCCGCCGCCCGGGGCCCACCTGGTGATTGGAGGCGTCCGCGTCGAGGTTGGGGTAACCGGGTTGCGGTACCTCGGCCTCGAATTGGACGGTCGTTGGAACTTCCGCGCTCACTTCGAGAAGTTAGGCCCTCGGCTGATGGCGACGGCTGGCTCGTTGAGCCGGCTCTTGCCAAACGTTGGGGGGCCCGACGCAGTAGTACGTCGTCTCTACGTGGGGGTGGTGCGGTCCATGGCACTATATGGGGCCCCCGTGTGGTGCCACGCCCTGACTCGCAGGAACATCGCGGCCCTGCGACGCCCGCAGCGTGCAATCGCGGTCAGGGCGATCCGTGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCGTTCTCGCCGGGACGCCTCCCTGGGACCTGGAGGCGGAGGCGCTCGCCGCCGATTATGCGTGGCGATGTGACCTTCGCGACAGGGGGGAACCACGTCCCGGAGAAGGAGCGATTAGAGCGCGGAGGCTCCAATCTCGGCGGTCTGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGAACCCGTCGGCCAGTCTCCGGACTGTCGAGGCGGTGCGCCCGGTCCTTGCGGAATGGGCGAACCGTGACCAAGGGCGTCTCACCTTCCGGTTGACGCAGATGCTTACCGGCCATGGGTGTTTTGGCCGGTACCTGCATCGCATCGCCCGGAGGGAACCGACGATGGAGTGTCACCACTGTGACTGCGACGAGGACACGGTCGAGCATACGCTCGCATATTGCCCCGCATGGCTGGAGCAACGCCGTGTCCTTGTCTCGCAAATAGGACCGGACTTATCGCTGCCGACCGTCGTGGCCACGATGCTCGGCAGCGATGAGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTACACCATCTCGCAGAAGGAGGCGGCGGAACGAGAGAGGGAGAGCTCATCCCTCTCCGCACCTATCCGTCGCCGCCGAGCCGGGGGCCGGAGAAGGGCCTTTGCCCGACTCCGGCCCCTGTAG
Protein
MDVAWTEVVKRGNKNKKRVPAAARPQPAPAAAASHQEGRAAAQGKNKRRRNGKPRAPRSAAVVLELLPAAKEKGITYMEVMSRARGAVDVDAIGVEGGLKVRHTANGARLLECPGAQSGAAADRLVARLREILPDPEIVRIERPVKMAEVKLTGLDECATQDEVAAAIASQGNCALAHVKVGELRSTYSGARTAWARCPVQAAILLATSKWEACQHAWKAARRLDHGSGATTGGKTLAMPPALRYWSGHKAATCTAVPHCVLCDAAKRQADHRAGGPACRSAPSSTKRRRGGKNKRKKGAEEVPAANGVAGELVPAAAVEPEGGTGEGATDANLNHSARAQDLLVHTMAEWSIDVAVAAEPYFVPADQDSWIGDIDGSVAIIIRQAAALPPLVMVARGSGYVAARVDETVVIGVYFSPNRHLAEFERFLGGFEALVNRLGSRPVILAGDLNAKWVAWGSPRPNSRGRMLSEWAIAAGLCLLNRGSVATCVRWNGESHVDVTFASPSIARRTRGWRVLEGAETLSDHRYVRFELSASSRSASAMVARGEEELPRSTPRSFPRWALKRLNKELLVEAAAVAAWAPVPASPVDVESEADWFRGTMCRTCDAAMPRVGGHAPRGGAYWWSPNIAQLRHADAPGDARSGSLGAPIQNCPQEIAAVGSPMTERLQPRQLREIVSALFPQGEGTFRPPFMGTPPHHDGGDAPADVPSPKISGAEIRAAVSKMRRKDAAPGPDGIHGRVWDLVFGALGDRLVRLFEACLESGRFPTQWKTGKLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVRHLTGTGPDLSAEQYGFREGSSTIDAIMRVRALSDEAVARGGVALAVSLDIANAFNTLPWSVIAGALEYHCVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVERGVPQGSVLGPLLWNIGYDWVLRGALHSPLPGLRVVCYADDTLVMARGKDYHESARLACAGVAFVVGNIRRLGLEVALEKSQALLFHRAGREPPPGAHLVIGGVRVEVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDAVVRRLYVGVVRSMALYGAPVWCHALTRRNIAALRRPQRAIAVRAIRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRDRGEPRPGEGAIRARRLQSRRSVLEAWSRRLANPSASLRTVEAVRPVLAEWANRDQGRLTFRLTQMLTGHGCFGRYLHRIARREPTMECHHCDCDEDTVEHTLAYCPAWLEQRRVLVSQIGPDLSLPTVVATMLGSDESWKAMLDFCEYTISQKEAAERERESSSLSAPIRRRRAGGRRRAFARLRPL

Summary

EMBL
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078935    BAC06462.1    D85594    BAA19776.1    KZ149896    PZC78733.1    LBMM01004272    KMQ92618.1    RSAL01003504    RVE40273.1    LBMM01006671    KMQ90407.1    LBMM01012412    KMQ86235.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01008278    KMQ89009.1    LBMM01005474    KMQ91485.1    LBMM01007036    KMQ90099.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    LBMM01003988    KMQ92922.1    LBMM01014122    KMQ85315.1    LBMM01008445    KMQ88871.1    LBMM01008422    KMQ88894.1    LBMM01015285    KMQ84870.1    GGMR01015159    MBY27778.1    GALA01001777    JAA93075.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02041886    ABLF02011238    GGFJ01001369    MBW50510.1    GGMR01006838    MBY19457.1    GGFK01005660    MBW38981.1    AB090815    BAC57906.1    GGFJ01001370    MBW50511.1    GFXV01003903    MBW15708.1    GGFJ01001439    MBW50580.1    GGFL01004044    MBW68222.1    ABLF02009073    ABLF02030702    ABLF02042963    ABLF02034925    AB593321    BAK38639.1    GGMR01019493    MBY32112.1    GFXV01002090    MBW13895.1    ABLF02011183    ABLF02041884    KQ972691    KXZ75806.1    KQ972544    KXZ75869.1    GGMR01012748    MBY25367.1    KU543683    AMS38371.1    KXZ75807.1    AB593325    BAK38646.1    GGFJ01001453    MBW50594.1    GGFJ01001454    MBW50595.1    ABLF02018942    ABLF02041885    GAKP01002292    JAC56660.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    ABLF02018098    GGFL01001192    MBW65370.1    GGFL01004046    MBW68224.1    GGFJ01001727    MBW50868.1    AB593327    BAK38648.1    KU543682    AMS38369.1    ABLF02030663    ABLF02041312    GGFJ01001541    MBW50682.1    GGFL01004047    MBW68225.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF01421   Reprolysin
PF00098   zf-CCHC
PF00075   RNase_H
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR000663   Natr_peptide       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=3.63762e-09,     Score=152

Ontologies

Topology

Length:
1344
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05377
Exp number, first 60 AAs:
0.00043
Total prob of N-in:
0.00014
outside
1  -  1344
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
299.371709
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号