SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14107
Pre Gene Modal
BGIBMGA011391
Annotation
PREDICTED:_P_protein-like_[Amyelois_transitella]
Location in the cell
PlasmaMembrane   Reliability : 4.604
 

Sequence

CDS
ATGGCTGGCTGGAAGAGCTTCACAGAATGGATAGGTCTTTCGAAGCCACCCAAACGGGAGTTGGACAAGAGCCAGTATTCGCTGGTATCTTGCGGGGAACTCACCACGGACAACATTCAGCTATGGCTGGCTCTGCCTGACGAGGTGAAGAATGATCCTTCGTTGGCGTCCCTACGGCAGATGTACGAGAGAGACGGTGCTGTAGAAGCTACACCGTTAGCCACAAAATCGGGGAATCCAATCAAAGTACTGTCTTTAGTCGATCCTTCGCCCACAGCAGTAGGAGATACTGAAGTCTGCAGCGCGAAGAAAGACTCTAATGAGACTCCCACGATCACAGAAATTAAAGGAGCAGACAATGTACCAACAAACGAACATAAGAAGACGGAAAAGAAAACGAAACCAGCCTATTACATCAAGATGACAGTTCTGCTGGCGTGCTGGATTTTCTTCACAGTCATCTTCCTGACGCACGACGTTAAAAAGGAAACTAGGGGTGTCGCGTCCGTAGCGCCCGACGAAGTGAAAACTATGACGTCTGCATCTCTAGAAACGTCGCGCCCCCATAGCATCTTAATCAGGGTGTCGGGACCGTTCTTGGCGGAGAACGACGAAATCAAGCTCAATGATACAATAAAAGAGAGAACCAAAAGCGTCACAATGTGGCTTGAAAGCTCTCGGACGAATGCTACGAATTTGAAAGAGAAATCCGAGAACTGGACAATTTATTTAGATGAAGACGACACGTTGCCGGATTTCGGGGGAGCCGAGACGAGATCCGCGATCTTGAAATTGACGCCAGGGATATCTGCGAACGGGAACTGCTCCCTGAAAATTGTGACGACCTCAAGGACCGTTGTAGCTTTTAGCGTGGTACATAAGCTGGATCCAGTGGACGAGAATGTGGGTGTCATATACGCCTGCGTCCTCCTCGTCGGACTGTACGTCTTAATTATCTTTGAGATCATCAACCGTACGCTTGCGGCCGTGACGATGTCTACAATGTCCCTCGCAGCTTTAGTTTTGGCTGGAGATCGGCCCGCCCTGTCCGAAGTCATAACCTGGTTGAACGAGGAAACCTTGATCCTCCTCTTCAGTATGATGCTACTTGTTGCTATTATGGCTGAAACGGGAATCTTCGTGACCAAAGGTAAACTATGGCCGCTGATTCTGCTGCTATGCGCCATCACTGCAACGGTGTCCTCTATACTGGATAACGTCACCACCATTCTCCTCATGTCTCCAATCACCATACGATTATGCGAAGTCATGGAGCTGGATCCGGTGCCGATCCTCATGTTCATGGCGATATTCAGCAACATTGGAGGCACGGCGACCCCTGTCGGCGACCCGCCCAACGTGATTGTGGCTTCGAACCGAGCTGTCATCGATTCTGGTATTAATTTCGCCAATTTCACAGCTCACATGGCTCTGGGAATAATATTAGTGTTCTGTCAGACGGCCATGCAGATAAGATACGTCTTCCGTGATTCGAATAAACTTAGACTGACAGTGCCCAAGGAGATCAGAGGCCTTAGCCATCAGATCTCGATATGGCGGCGGGCGGCCGATTCCCTCCCGCACCTCAGCAAAGACGTGCAAGTCGTCAGAGAGAGGCTCGAGAGGAAGATACGGAAGCTGACCGTGGAATTGGACGTCTTAATCAAGAAGAGCAACAGCCGCGCTTGCCCCGAAGAGACATTCCAAACTACCCTCAAAGAAATGAAAGAAAAGTACAAGATAAGAGATAAAGCTCTGCTGATCAAAGCTTCAGTGGCCGTCTGCTTTGTGGTCGTGGTATTCTTCTTGCACTCAATGCCGGCTCTAGACCGCGTGTCCCTGGGCTGGACGGCGTTGCTGGGCGCGATCCTGCTGCTGATCCTGGCGGACCGCGAGGACCTGGAGCCGGTGCTGCACCGAGTAGAGTGGTCCACGCTGCTGTTCTTCGCGGCCTTGTTCGTACTCATGGAGGCGTTGTCGAAACTGGGCTTAATATCGTACATCGGAGGTATCATGGAACTGCTGATTCTGAGGGTAGACGAGAGCTCCAGACTGGCAGTCGCCATTTTGCTAACTTTGTGGGTTTCCGGTGTGATATCGGCTTTCGTTGACAACATACCGCTGACAACCATGATGGTCCGCGTCGTGGTCTCCATGGGATCGAACTTAAAGCTCGACCTGCCTATGCAGCCATTGATCTGGGCTTTATTGTTCGGCGTCTGTTTGGGAGGTAAGACTATAGATCATACGCTAATTTACGAAAGCTAA
Protein
MAGWKSFTEWIGLSKPPKRELDKSQYSLVSCGELTTDNIQLWLALPDEVKNDPSLASLRQMYERDGAVEATPLATKSGNPIKVLSLVDPSPTAVGDTEVCSAKKDSNETPTITEIKGADNVPTNEHKKTEKKTKPAYYIKMTVLLACWIFFTVIFLTHDVKKETRGVASVAPDEVKTMTSASLETSRPHSILIRVSGPFLAENDEIKLNDTIKERTKSVTMWLESSRTNATNLKEKSENWTIYLDEDDTLPDFGGAETRSAILKLTPGISANGNCSLKIVTTSRTVVAFSVVHKLDPVDENVGVIYACVLLVGLYVLIIFEIINRTLAAVTMSTMSLAALVLAGDRPALSEVITWLNEETLILLFSMMLLVAIMAETGIFVTKGKLWPLILLLCAITATVSSILDNVTTILLMSPITIRLCEVMELDPVPILMFMAIFSNIGGTATPVGDPPNVIVASNRAVIDSGINFANFTAHMALGIILVFCQTAMQIRYVFRDSNKLRLTVPKEIRGLSHQISIWRRAADSLPHLSKDVQVVRERLERKIRKLTVELDVLIKKSNSRACPEETFQTTLKEMKEKYKIRDKALLIKASVAVCFVVVVFFLHSMPALDRVSLGWTALLGAILLLILADREDLEPVLHRVEWSTLLFFAALFVLMEALSKLGLISYIGGIMELLILRVDESSRLAVAILLTLWVSGVISAFVDNIPLTTMMVRVVVSMGSNLKLDLPMQPLIWALLFGVCLGGKTIDHTLIYES

Summary

EMBL
KQ459593    KPI96275.1    NWSH01000786    PCG74209.1    BABH01009882    BABH01009883    + More
RSAL01000061    RVE49595.1    ODYU01005849    SOQ47140.1    NWSH01000477    PCG76127.1    KZ150482    PZC70721.1    KZ150171    PZC72608.1    KPI96269.1    UFQT01000114    SSX20252.1    GANO01004039    JAB55832.1    GL440100    EFN66302.1    KQ459875    KPJ19669.1    APCN01004223    AAAB01008984    EAA14953.3    NNAY01001501    OXU23779.1    GFDF01009081    JAV05003.1    AXCM01000685    KQ434769    KZC03779.1    AXCN02000773    KQ414714    KOC62923.1    CH477477    EAT40274.1    GDUN01001018    JAN94901.1    ADMH02001962    ETN60233.1    GFDL01009032    JAV26013.1    GFDL01008936    JAV26109.1    GFDL01008962    JAV26083.1    GFDL01008994    JAV26051.1    KQ761557    OAD57387.1    CVRI01000054    CRL00831.1    CH916368    EDW04221.1    GAPW01000206    JAC13392.1    CH940661    KRF85587.1    KRF85588.1    KRF85586.1    CP012523    ALC40049.1    CH379060    KRT04193.1    KRT04195.1    CH902624    KPU74379.1    OUUW01000004    SPP79150.1    EDW71255.1    GDHF01014279    JAI38035.1    KPU74378.1    GFDL01008953    JAV26092.1    CH933807    KRG02677.1    EDW11406.1    SPP79151.1    KRT04194.1    KRG02678.1    GDHF01018577    GDHF01006502    GDHF01005578    GDHF01004669    JAI33737.1    JAI45812.1    JAI46736.1    JAI47645.1    GAKP01022216    GAKP01022212    JAC36740.1    EDV33264.2    CM000361    CM002910    EDX03761.1    KMY88162.1    CH480820    EDW54289.1    JRES01000827    KNC28051.1    KMY88169.1    CH479180    EDW29020.1    EAL33792.1    JXUM01060995    JXUM01060996    KQ562130    KXJ76619.1    GBXI01010849    JAD03443.1    AE014134    AY050571    BT016131    AAF50960.3    AAL11433.1    AAO41154.1    AAO41155.1    AAO41156.1    AAV37016.1    AGB92596.1    KMY88165.1    NWSH01006611    PCG63333.1    GBXI01015385    JAC98906.1    AF145605    AY050572    AAD38580.1    AAF50961.1    AAL11434.1    CM000157    KRJ97776.1    KRJ97777.1    KRJ97778.1    CH954177    KQS70133.1    KQS70134.1    KA646955    AFP61584.1    BT044574    AAF50959.2    ACI16536.1    AHN54122.1    EDW88427.1    CH963920    EDW77603.1    KRF98706.1    EDV57786.1   
Pfam
PF03600   CitMHS        + More
PF01593   Amino_oxidase
Interpro
IPR004680   Cit_transptr-like_dom        + More
IPR036188   FAD/NAD-bd_sf       
IPR002937   Amino_oxidase       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
4F35     E-value=5.9931e-05,     Score=113

Ontologies

Topology

Length:
755
Number of predicted TMHs:
10
Exp number of AAs in TMHs:
224.18489
Exp number, first 60 AAs:
0.00079
Total prob of N-in:
0.94812
inside
1  -  135
TMhelix
136  -  158
outside
159  -  301
TMhelix
302  -  324
inside
325  -  359
TMhelix
360  -  382
outside
383  -  385
TMhelix
386  -  408
inside
409  -  428
TMhelix
429  -  448
outside
449  -  462
TMhelix
463  -  485
inside
486  -  584
TMhelix
585  -  607
outside
608  -  611
TMhelix
612  -  629
inside
630  -  648
TMhelix
649  -  671
outside
672  -  685
TMhelix
686  -  708
inside
709  -  755
 
 

Population Genetic Test Statistics

Pi
216.953115
Theta
152.393285
Tajima's D
1.314064
CLR
0.424146
CSRT
0.741112944352782
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号