SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14105
Pre Gene Modal
BGIBMGA011390
Annotation
PREDICTED:_P_protein-like_isoform_X1_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.899
 

Sequence

CDS
ATGCGCAAGACGAGCACTTCCGCCTACGTAAAGCACTTGATAAAAATCTCTATACTCCTGGCATGCTGGATGTTCTTCACGATCGTCTTCATGATGTACAATGAGAAGGTGGAAGTGTTCATGAGCTCGTCCGTGGCTCCGGGAGAGGTCAAGAGCTACATCATAGACTTAAAAGAGGACAAGCTATCATTGTCCTTAAGCCTTTCTGGGCCGTTCCTCTCGGAGCAGTGGCAGGCCAAGTTGAATTCCACGGAGGGAGTAAAGAAGATGGAGGTTTGGCTTGAAAGGCGGCCCGATGATGACAGCAGAGGAGTATCGGTCGAGATATCAAAGACATGGGAAATAGTATTGCTAGAGAACGAAACGGATTTCTGTGAGGGCGAACTGAGGTCGAACGTTCTAGAATTGAAGACGTTGAACGCAACCAATAATGGGTCTTACGCTGTCGCGATAAGAACTAACGCGAACGAGACGATACCGTTCCAAATGAGCTACAAGATTGAGCCGCTGGATCAGACTTCGGGAGTGATTTACGCTTCAATTTTACTGCTGGGGTTGTATGTTCTGATAATATTTGAGATCATAAACCGAACCATGGCAGCAGTTATCCTGTCAACAACGGCCATGGCCGTCCTCTCGTTACTAGGCGAAAGGCCTTCCTTGCCAGAATTGATCTCGTGGCTGGATATGGAGACGTTGCTGCTGCTCTTTAGCATGATGCTGCTTGTAGCGATCATGGCTGAGACGGGACTGTTCGACTATCTCGCCGTCTACACATTTGAGGTTACAAGAGGGAAGATCTGGCCCCTGATCTCCGTTCTGTGCGGAATAACGGCGATGCTATCAACATTTTTAGACAACGTTACAACTGTATTACTAATGACACCGGTCACAATAAGGTTATGTGAAGTGATGGATATGGATCCTATTCCCGTACTGATGTCCATGGTCATATACAGTAATATTGGTGGGACCGCTACTCCTGTGGGCGATCCGCCCAACGTTATAATAGCTTCAAATAAAGCTGTTAGTCAAGCTGGGATAAACTTCACGAATTTCACATTGCACATGGCACTGGGAATCGTCTTCGTGTGTCTGCAGACCTACGTTCAATTGAGATTCATTTATCGAGACACGAATAGGCTACGTTTAAACGAACCAAGAGAGATACAAGATCTCCGCCAACAAATCTCGATATGGCGTCGCGCCGCCGACTCCCTCCCGCATCTCAGTAGAGACGAACAGGTGGTCAGAGAGAGACTCGACAAGAAGATACGTAAATTGACTTCCCAGTTGGATCTTTTCGTTAGGGAGAGTAAAAAGAGAGCCTGCCCTAAGACCACATTCAGGAGCACCTTGGCCGAGATGAAAGAGAAGTACAAGATTCGCAATAAGCCGTTATTGGCGAAATCTTCAGTGGCCATCGGTTTCGTCGTGCTTGTGTTCTTCTTGCACTCCATACCGGAATTCAATCGCGTGTCCCTGGGCTGGACGGCGTTGCTGGGCGCGATCCTGCTGCTGATCCTGGCGGACCGCGAGGACCTGGAGCCGGTGCTGCACCGAGTCGAGTGGTCCACACTGCTGTTCTTCGCGGCACTCTTTGTTTTTATGGAGGCCCTCTCGAAGTTGGGGCTCATCGTTTTCATTGGAGGCCTCACGGAGTCCATCATTCTCAAGGTGGACGAAAGTGCTAGACTGGCCGTGGCGATACTGCTTATTTTGTGGGTGTCAGGTTTGACGTCGGCCTTCGTAGACAACATCCCGCTGACGACCATGATGATCAGAGTGGTGACCTCGCTCGGGTCGAACCCGAACCTCAATCTTCCGATGCAGCCGCTGATCTGGGCACTTTGCTACGGAGCTTGTCTAGGAGGTAACGGTACCCTGATAGGCGCGAGCGCCAACGTGGTCTGCGCTGGCGTGGCTGAGCAACACGGATACAAGTTCACCTTCATGAACTTCTTCAAAATAGGCTTCCCGATCATGATAGGCCACTTGGTCGTAGCCTCACTGTACCTGATTATATGCCACTGCGTTTTTGCCTGGCATTGA
Protein
MRKTSTSAYVKHLIKISILLACWMFFTIVFMMYNEKVEVFMSSSVAPGEVKSYIIDLKEDKLSLSLSLSGPFLSEQWQAKLNSTEGVKKMEVWLERRPDDDSRGVSVEISKTWEIVLLENETDFCEGELRSNVLELKTLNATNNGSYAVAIRTNANETIPFQMSYKIEPLDQTSGVIYASILLLGLYVLIIFEIINRTMAAVILSTTAMAVLSLLGERPSLPELISWLDMETLLLLFSMMLLVAIMAETGLFDYLAVYTFEVTRGKIWPLISVLCGITAMLSTFLDNVTTVLLMTPVTIRLCEVMDMDPIPVLMSMVIYSNIGGTATPVGDPPNVIIASNKAVSQAGINFTNFTLHMALGIVFVCLQTYVQLRFIYRDTNRLRLNEPREIQDLRQQISIWRRAADSLPHLSRDEQVVRERLDKKIRKLTSQLDLFVRESKKRACPKTTFRSTLAEMKEKYKIRNKPLLAKSSVAIGFVVLVFFLHSIPEFNRVSLGWTALLGAILLLILADREDLEPVLHRVEWSTLLFFAALFVFMEALSKLGLIVFIGGLTESIILKVDESARLAVAILLILWVSGLTSAFVDNIPLTTMMIRVVTSLGSNPNLNLPMQPLIWALCYGACLGGNGTLIGASANVVCAGVAEQHGYKFTFMNFFKIGFPIMIGHLVVASLYLIICHCVFAWH

Summary

EMBL
BABH01009882    BABH01009883    ODYU01005849    SOQ47140.1    RSAL01000061    RVE49595.1    + More
NWSH01000786    PCG74209.1    KQ459593    KPI96275.1    KQ459875    KPJ19670.1    KZ150482    PZC70721.1    NWSH01000477    PCG76127.1    KZ150171    PZC72608.1    GANO01004039    JAB55832.1    GFDF01009081    JAV05003.1    KPI96269.1    KPI96273.1    AXCN02000773    ADMH02001962    ETN60233.1    AAAB01008984    EAA14953.3    APCN01004223    JXUM01060995    JXUM01060996    KQ562130    KXJ76619.1    AXCM01000685    GAPW01000206    JAC13392.1    UFQT01000114    SSX20252.1    NNAY01001501    OXU23779.1    CVRI01000054    CRL00831.1    GFDL01008953    JAV26092.1    GFDL01008936    JAV26109.1    GFDL01008962    JAV26083.1    GFDL01009032    JAV26013.1    GFDL01008994    JAV26051.1    GDUN01001018    JAN94901.1    KQ434769    KZC03779.1    CH477477    EAT40274.1    GAKP01022216    GAKP01022212    JAC36740.1    GDHF01018577    GDHF01006502    GDHF01005578    GDHF01004669    JAI33737.1    JAI45812.1    JAI46736.1    JAI47645.1    GBXI01010849    JAD03443.1    GBXI01015385    JAC98906.1    GAMC01021322    JAB85233.1    GAMD01000808    JAB00783.1    CH916368    EDW04221.1    KA646955    AFP61584.1    KK852579    KDR20906.1    CH940661    KRF85587.1    KRF85588.1    GL440100    EFN66302.1    EDW71255.1    KRF85586.1    CM002910    KMY88169.1    CM000361    EDX03761.1    KMY88162.1    KMY88165.1    CH479180    EDW29020.1    CH480820    EDW54289.1    BT001540    AAN71295.1    AF145605    AE014134    AY050572    AAD38580.1    AAF50961.1    AAL11434.1    AY050571    BT016131    AAF50960.3    AAL11433.1    AAO41154.1    AAO41155.1    AAO41156.1    AAV37016.1    AGB92596.1    CH379060    KRT04194.1    CM000157    KRJ97778.1    CH954177    KQS70133.1    KQS70134.1    BT044574    AAF50959.2    ACI16536.1    AHN54122.1    KRJ97776.1    KRJ97777.1    CP012523    ALC40049.1    KRT04193.1    KRT04195.1    EDW88427.1    EDV57786.1    OUUW01000004    SPP79151.1    NEVH01012082    PNF30980.1    SPP79150.1    EAL33792.1    CH933807    KRG02677.1    EDW11406.1    CH902624    KPU74378.1    KRG02678.1    KPU74379.1    KMY88167.1    CCAG010022036    EDV33264.2    DS235774    EEB16827.1    CH963920    KRF98706.1   
Pfam
PF03600   CitMHS
Interpro
IPR004680   Cit_transptr-like_dom        + More
IPR036188   FAD/NAD-bd_sf       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
4F35     E-value=2.14213e-07,     Score=134

Ontologies

Topology

Length:
683
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
254.57012
Exp number, first 60 AAs:
21.12431
Total prob of N-in:
0.99800
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  32
outside
33  -  172
TMhelix
173  -  192
inside
193  -  198
TMhelix
199  -  216
outside
217  -  235
TMhelix
236  -  258
inside
259  -  269
TMhelix
270  -  292
outside
293  -  352
TMhelix
353  -  375
inside
376  -  465
TMhelix
466  -  488
outside
489  -  492
TMhelix
493  -  510
inside
511  -  529
TMhelix
530  -  552
outside
553  -  566
TMhelix
567  -  589
inside
590  -  614
TMhelix
615  -  637
outside
638  -  656
TMhelix
657  -  679
inside
680  -  683
 
 

Population Genetic Test Statistics

Pi
204.735691
Theta
159.326167
Tajima's D
1.119002
CLR
0.454677
CSRT
0.695765211739413
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号