SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14089
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like?_partial_[Papilio_polytes]
Location in the cell
Nuclear   Reliability : 2.276
 

Sequence

CDS
ATGGAACACGCGCGTCCTCCAGCAGAATTATCACTCGATGGTGGTCCGGCTGCACGCTCCGAGGCGTGGCGGCAATGGCGGAAGCTGTTCGAAGTATTTCTTAAAGCGTCTGGAGTGAGCAAAGAGCCTAAAGAAGTTCAGGCTAGTTTGTTGGTGAATCTCATAGGATCGGCCAGTTACGAGGTTTATACGACCTTCACTTTTAACGAAGGTGAAAGTGAGGATGATATCGACTGTGTTCTGAATAAGTTCGACAAGTACTTTGGAGCAAAACCGAATATCATAGTAAGACGGTATAAGTTCTTCACCCGTGATCAAGAAGATGGCGAAAATATTGACCAATACATAACCGCATTGAGGGTACTGAGTCAGCAATGCGAATTCAGTGAATTACACGAAAGCTTGTTACGTGATCGTATCGTATGCGGTGTCAATAACAACACGGTGAGAGATCGACTTCTTCGCACTGATGATCTTACACTAGTGAAGGCCTTACAACTCTGTCAGGCGGCCGAGATGTCTAAAGAGGACAGTAAATACATTAACTGCGCTGCGGACAGTGTGCAAGTGTCTGCAGTTCAGAACAGAAGCGGTGAACGAAGCGGACAGCGCGCGAGAGGAGTACGCGGCGTAAGAGTTGGCAGTAACGGCGGACAGAGAACAGCTCGCAGAGCCTGTCAGCGATGTGGAAACAGCCGGTGTCTAGGCGGTGAACGTTGTCCAGCAGTTAATGCGATGTGTTTTGTGTGCGATCAGAAAGGGCATTTTTCGCGAGTATGTGTGCAAAGGAAAGCGATTCGTAAGGTATTAAATTTGAGTATGGATACTGCGAGCAGTGATAGTGAAGAAAAATGCAAAGAAATGTTCTATGTGAATACGATCGTGGGGAACAATAACATATACTTGTTTCAAGGTCTAGGAAAATTACCTGGTAAATATAGTATTGTAATAAATAAAAACATACAGCCTGTTGTTAGTCCAACGAGAAAAATTCCCTTAGGAATTAAAGGTAAATTGTTGGACGAGTTACGTAGAATGGAAGAGTTAGGTGTGGTTAGAAAGGTCACACACCCGACCGATTGGGTGAATGCAATTGTTTTAATCGCAAAAAAGGACGGTGGCATTCGTGTATGTTTAGACCCCCGTCCGCTGAACCGCGCGGTGCGGCGCGCCCAGTACACGTTGCCGACAGTGTCTGAGCTGGCAGCGCGTCTGCGCGGTGCCACTGTGTTCAGCGTGCTCGATGCGCGCTGTGGGTTCTGGATGGTACAGATAGACGACGCCAGCGCTGATCTGTGCACCTTCGGTACTCCGTTCGGCCGGTATCAATTTTTACGTTTACCGTATGGGATAAACTGTGCGCCTGAAGTGTTTCATGCTAAACTCAGGCAACATTTGGAAGACTTAGATGGTGTGGAGTCTTTCATCGATGACGTCATAATATGGGGACGCACAAAGGAAGAGCATGATAGGAGGTTGGAGTGCCTTTTACAGCGTGCTAAGGAAGTAGGCATAAAGTTTAATCGCGATAAATGTAAATTCGGTGTACCCGAAATTACTTACCTAGGTCATAAGTTCGACGCGAATGGTATGCGGGCAGATGACTCAAAAGTCAAAGCTATTTTAGAAATGCCTTATCCGAAAGATAGGAACGCGTTAGAGAGATTTTTAGGCATGGTTAATTATTTAGCTAAATTTATTTCTAATTACTCTGAGAGTGTGAATGTGTTACGGACCTTACTGAAAAAGGAATCCGAGTGGTTCTGGGAATCGCATCATTCCGAAGCTGTGGACAAGCTAAAAATGAAGCTTAGCTGTGCGCCCGTGCTGGCATTATACAGTGAGAGTGTACCGATAGTAGTGTCGGTGGACGCATCCAGTGTGGCGCTGGGTGCCGTGCTGCTACAGGACGGTCGTCCGGTAGAGTTCGCATCACTTACGCTCACCGACACTCAGACTAGGTATGCACACATAGAAAAGGAAATGCTAGCTATTGTGTTTGGGATTGAGCGGTTCAGGCAGTATATTTACGGTAGGTCCGACGTAACCGTACATACTGATCACAAGCCCCTAGAAGCATTATTCAACAAACCACTAGTTTCGGTTCCAGCTCGGTTGCAGAGGATGATGATGAGAGTGCAAGGGATGTGGAGCGAGAGGTGCGGCGGTGCGCAGCGTGTGCGTTACACGCGCCTCGACCGCGCCGGCAACCGCTTCTACAGCACCCTGTGCCCGCGCTACCCTGGCATAAACTAG
Protein
MEHARPPAELSLDGGPAARSEAWRQWRKLFEVFLKASGVSKEPKEVQASLLVNLIGSASYEVYTTFTFNEGESEDDIDCVLNKFDKYFGAKPNIIVRRYKFFTRDQEDGENIDQYITALRVLSQQCEFSELHESLLRDRIVCGVNNNTVRDRLLRTDDLTLVKALQLCQAAEMSKEDSKYINCAADSVQVSAVQNRSGERSGQRARGVRGVRVGSNGGQRTARRACQRCGNSRCLGGERCPAVNAMCFVCDQKGHFSRVCVQRKAIRKVLNLSMDTASSDSEEKCKEMFYVNTIVGNNNIYLFQGLGKLPGKYSIVINKNIQPVVSPTRKIPLGIKGKLLDELRRMEELGVVRKVTHPTDWVNAIVLIAKKDGGIRVCLDPRPLNRAVRRAQYTLPTVSELAARLRGATVFSVLDARCGFWMVQIDDASADLCTFGTPFGRYQFLRLPYGINCAPEVFHAKLRQHLEDLDGVESFIDDVIIWGRTKEEHDRRLECLLQRAKEVGIKFNRDKCKFGVPEITYLGHKFDANGMRADDSKVKAILEMPYPKDRNALERFLGMVNYLAKFISNYSESVNVLRTLLKKESEWFWESHHSEAVDKLKMKLSCAPVLALYSESVPIVVSVDASSVALGAVLLQDGRPVEFASLTLTDTQTRYAHIEKEMLAIVFGIERFRQYIYGRSDVTVHTDHKPLEALFNKPLVSVPARLQRMMMRVQGMWSERCGGAQRVRYTRLDRAGNRFYSTLCPRYPGIN

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=1.72768e-43,     Score=446

Ontologies

GO

Topology

Length:
751
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01312
Exp number, first 60 AAs:
0.00147
Total prob of N-in:
0.00020
outside
1  -  751
 
 

Population Genetic Test Statistics

Pi
346.972809
Theta
179.924349
Tajima's D
2.834341
CLR
2.998962
CSRT
0.968901554922254
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号