SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14067
Pre Gene Modal
BGIBMGA011225
Annotation
Solute_carrier_family_22_member_13_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 4.872
 

Sequence

CDS
ATGGCACCCCAAGAACGTACCCCTTATGTGGCCGAAGAAGAGAGCCATCCGGACTCGTCGAAGGACTTGCAAAACGTAAATTTGGGCGGGAGTTACGTTAACAGCGCCTATCAAAATGACAGTTCCGATAATGTTGCCATACCGAAAAACGCAGAGAACGTTGCCAACAATAACAACAACGAAAAACCGAAGAAGGAAACGGATTTCGACGATCTATTGCCGCACGTCGGAGAATTTGGACTGTACCAGAAGATTCTGTTCCTGCTCATGATCCCTTTTGCGTTTTTCGTTGCCTTCGTTTATTTCTCGCAAATATTCATGACCCTAACGCCGGAGCAACACTGGTGCTGGGTACCTGAGCTGGCAAACCTAACAGCGGAAGAACGGCGAGCGTTGGCGATACCGCCCAAAACGGACGGCCCGTTCGCCCATGACAGGTGCCATATGTTCTCAACCGACTGGGCTAAAGCGTTGGCTGAAGGCAGAACGACACCAGATGATGAATGGCAAATAGTTCCATGCGATAAAGGCTGGGAGTACAACAAGAGCGATGTTCCTTACGACACAATCGCTTCACAGCTAGACTGGGTGTGCGAGAAAGACAATCTGGCGGCCACTGCCCAGGCTATCTTCTTCTGCGGCGCCATCGTGGGCGGACTTGTGTTCGGCTGGATCGCGGATAAATATGGAAGAATACCAGCTTTAGTTGGCACGAATTTGATTGGGTTCGTCGCCGGCGTTGCGACTGCCTTCTGCAACAGTTTCTGGTCGTTCGCGCTTTGCCGTTTCCTGGTGGGGCTGGCCTTCGACAACTGCTTCACCATGATGTACATCTTAGTTCTAGAGTACGTCGGCCCGAAATGGAGGACGTTCGTGGCTAACATGTCCATAGCGTTGTTCTTCACGTTGGCTGCTTCTCTGCTACCCTGGATCGCGCTGTGGGCAGACGACTGGCGGACATTCGCACTGGTGACATCTGCACCTTTCATCATTGCTATTGCAACACCCTGGCTCGTCCCGGAAAGCGCAAGATGGCTGGTCTCACAAGGAAAAATAAACAAAGCCTTGTTTATAATGAAGAAATTCGAAAGGATCAACAAGACTAAAATACCTGAGAAGGTCCTAAGTGAATTCACGGAATCATCAATAAAAGCCATCAAGGAATCAGAATCTCAGTCAAAGACCTATTCCGTCTTGGACCTGTTCAGGACGCCGCGATTGCGAAGGAACTCGATCTTGCTCATCGTTATATGGATGGCCATTTCCTTGGTCTTCGACGGTCACGTGAGGAATGTAGGTTCTCTGGGCTTGGACATATTTCTGACGTTCACAATAGCTTCGGCCACCGAGCTACCGGCTGATACGTTTTTGACGGCGGTGCTTGACAGATGGGGCAGGAGATGGTTGGCATGTGGTTCTATGGTGGTCAGCGGAGTTTTCAGTCTCCTCGCCACAGCAGTTCCCGTTGGAGGTCCATCGGCATCTCTGGCCATCTTGGGCCGATTCGCCGTGAACATCTCATACAACATTGGCCTTCAGTACGCGGCTGAGCTGCTGCCCACGGTCGTTAGAGCCCAGGGCGTCGCTCTCATCCACATCATGGGCTACGTTGCGTCAATTCTGGCCCCGTTTGTGGTGTATCTGGCTAACATCTCACCGGATTTACCGCTGTTGATCTTGGGTGCCCTCGGCGTGGTGGGCGGCATGCTGTGCCTTTTCCTACCGGAGACTATGGACACGGAGATGCCCCAGACCCTGCAAGATGGAGAGGACTTCGGCAAGGACCAGCAGTTCTGGGACAATCCTTGCTTCCCTAGAAAATCAAAATCGGACGACCTGCAAGAGCAATATCGGAAGAGACCCTCAGTTTCTCCCATTCGAGAGGAAACAAAGGACTTCATCAGGGCGATGCCGAGTGCTATAAGCTCTAGAGCTTCAATACGAGCTTCCGTCAGAGCTTCGACCAGAGGATCGACGAGAAGACGTAACGAAAGTCAAAACATAGTCTGA
Protein
MAPQERTPYVAEEESHPDSSKDLQNVNLGGSYVNSAYQNDSSDNVAIPKNAENVANNNNNEKPKKETDFDDLLPHVGEFGLYQKILFLLMIPFAFFVAFVYFSQIFMTLTPEQHWCWVPELANLTAEERRALAIPPKTDGPFAHDRCHMFSTDWAKALAEGRTTPDDEWQIVPCDKGWEYNKSDVPYDTIASQLDWVCEKDNLAATAQAIFFCGAIVGGLVFGWIADKYGRIPALVGTNLIGFVAGVATAFCNSFWSFALCRFLVGLAFDNCFTMMYILVLEYVGPKWRTFVANMSIALFFTLAASLLPWIALWADDWRTFALVTSAPFIIAIATPWLVPESARWLVSQGKINKALFIMKKFERINKTKIPEKVLSEFTESSIKAIKESESQSKTYSVLDLFRTPRLRRNSILLIVIWMAISLVFDGHVRNVGSLGLDIFLTFTIASATELPADTFLTAVLDRWGRRWLACGSMVVSGVFSLLATAVPVGGPSASLAILGRFAVNISYNIGLQYAAELLPTVVRAQGVALIHIMGYVASILAPFVVYLANISPDLPLLILGALGVVGGMLCLFLPETMDTEMPQTLQDGEDFGKDQQFWDNPCFPRKSKSDDLQEQYRKRPSVSPIREETKDFIRAMPSAISSRASIRASVRASTRGSTRRRNESQNIV

Summary

EMBL
KQ459875    KPJ19680.1    KQ459593    KPI96286.1    BABH01009804    BABH01009805    + More
NWSH01000178    PCG78709.1    GECZ01018651    JAS51118.1    GEBQ01024996    JAT14981.1    AGBW02009123    OWR51600.1    KQ971321    EFA00687.1    GEZM01052731    JAV74290.1    GECL01001415    JAP04709.1    GDUN01000921    JAN94998.1    OWR51601.1    GL447693    EFN86109.1    GFTR01007453    JAW08973.1    KK107419    QOIP01000003    EZA51081.1    RLU24986.1    GBBI01004623    JAC14089.1    ACPB03009635    ACPB03009636    ACPB03009637    ACPB03009638    ACPB03009639    NNAY01001101    OXU25136.1    KPJ19681.1    GAMD01001231    JAB00360.1    KQ414596    KOC69917.1    AXCN02000878    AAAB01008960    EAA11678.4    GL444080    EFN61301.1    KQ434878    KZC09853.1    GFDL01001826    JAV33219.1    NEVH01007822    PNF35272.1    KPI96288.1    KQ769818    OAD52819.1    ADTU01004402    ADTU01004403    ADTU01004404    ADTU01004405    GL887605    EGI70657.1    CVRI01000042    CRK95636.1    DS235184    EEB13063.1    KQ980249    KYN17104.1    KK852417    KDR24330.1    JRES01001371    KNC23290.1    GBXI01001560    JAD12732.1    KQ977004    KYN06495.1    UFQS01000037    UFQT01000037    SSW98016.1    SSX18402.1    SSW98015.1    SSX18401.1    GDHF01022741    JAI29573.1    OUUW01000009    SPP85099.1    GAMC01016163    JAB90392.1    KQ982821    KYQ50181.1    KQ976448    KYM85871.1    KQ981276    KYN43599.1    CH379069    KRT08150.1    KZ288416    PBC26059.1    CH933816    EDW17097.1    CH963847    EDW72947.2    ATLV01023587    KE525344    KFB49337.1    CH954178    EDV51090.2    CM002912    KMY97849.1    AE014296    AAF50706.2    GL768119    EFZ12162.1    CM000159    EDW93588.2    CH940647    EDW68875.2    RSAL01000031    RVE51608.1    CH902618    KPU78771.1    CP012525    ALC43177.1    KZ150153    PZC72816.1    ODYU01004909    SOQ45269.1    JRES01000930    KNC27191.1    GBYB01001152    JAG70919.1    CCAG010010771    PNF35273.1    APGK01053700    APGK01053701    KB741231    ENN72266.1    GDHF01014620    JAI37694.1    GFDF01009490    JAV04594.1    KA648236    AFP62865.1    AXCM01001383    APCN01002315    AJWK01023693    ADMH02001954    ETN60286.1    EAL29580.3   
Pfam
PF00083   Sugar_tr        + More
PF01663   Phosphodiest
PF07690   MFS_1
PF04389   Peptidase_M28
Interpro
IPR005828   MFS_sugar_transport-like        + More
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR005829   Sugar_transporter_CS       
IPR017850   Alkaline_phosphatase_core_sf       
IPR002591   Phosphodiest/P_Trfase       
IPR011701   MFS       
IPR007484   Peptidase_M28       
IPR037457   M28_QC       
SUPFAM
SSF103473   SSF103473        + More
SSF53649   SSF53649       
Gene 3D
PDB
6N3I     E-value=0.000152296,     Score=109

Ontologies

Topology

Length:
669
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
253.18592
Exp number, first 60 AAs:
0
Total prob of N-in:
0.98999
inside
1  -  84
TMhelix
85  -  107
outside
108  -  203
TMhelix
204  -  226
inside
227  -  234
TMhelix
235  -  257
outside
258  -  261
TMhelix
262  -  284
inside
285  -  290
TMhelix
291  -  313
outside
314  -  317
TMhelix
318  -  340
inside
341  -  411
TMhelix
412  -  429
outside
430  -  438
TMhelix
439  -  461
inside
462  -  467
TMhelix
468  -  490
outside
491  -  493
TMhelix
494  -  516
inside
517  -  528
TMhelix
529  -  551
outside
552  -  554
TMhelix
555  -  574
inside
575  -  669
 
 

Population Genetic Test Statistics

Pi
22.674025
Theta
188.155312
Tajima's D
0
CLR
141.69678
CSRT
0.364731763411829
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号