SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14062
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.809
 

Sequence

CDS
ATGACATTTGGCGCGTGGAACGTGAGAACGCTTCTTGATCGAGATGGCAACGCCTGCCCTGAACGCAAGACCGCCATAGTAGCTCGGGAACTTCATCGCTACAACGTAGATGTGGCTGCTCTCAGCGAAACACATCTTGCCGATGAAGGAGAGCTGGTGGAAGTAGGTGCTGGTTATACTTTCTTCTGGAAAGGTACCGCTGCCTCTGAAACGCGACACTCAGGTGTAGGATTTGCCATCAAGAATCACTTAGTAAAGCGATTAGAGGAGTACCCTGTACATATCTCGGACCGCGTTACCACACTGCGAGTTCACCTGGATAAAGACAATTACCTTAATGTCATCAGTGTATATGCTCCAACGCTTGACAAGTCTGATGACATTAAGGACAAATTCTATGGGGAAGTGACTCTTTGCCTTGACAGTATAAACGCCAGAGAGCAGGTACTATTGCTGGGCGACTTCAATGCCAGGGTTGGTCGGGACTATGAGGCTTGGCCTGGAGTTCTGGGTAGACACGGAGTCGGCAACATGAACAGCAATGGTCAGTTGCTGCTCAGTCTTTGTGCTCAATACGGTCTAGCAATTACGAACACTATGTTTAGACTTGCCGCTAAGTACAAGACAACATGGATGCACCCAAGATCCAAGCACTGGCATTTGATCGACTATGCTATCGTAAGGCAAAGAGATTTCAGCCAAGTGCAGATCACCCGTGTTATGCGTGGTGCGCACTGCTGGTCTGACCACCGACTTATTGTCACTAAGCTACGACTCCGCCTCCGCCGCCCGCGTAGATCTCCTATGAAAAAGCTTGCGTCTTTGGACATAGAGAAGCTAAGAGATCCTGAGGTGAGGAAGAACTATGCTGAAGTTTTGTCTAAGAAGCTGTTGCCAGTTAATGAGACAGGTGATGTTGATGCTGACTGGGGAGCTTTATCATCTCATATCATGGATACCGCTTCAATTGCACTGGGTAGGAAATGCTGTCGTAATGAAGACTGGTTTGATGGAAATGATGAAGTTTTGCGGGAGGCACTCGACAAACACCGTGATCTCTTGCGACAGCACAGAAGGCGTAAAGGAAGCGTTGCGGCGGTCAAAGCTAGTGACCTTGAACTGCGCAAGCTGTCTCGACAAATAAAAGACAAGTGGTGGCAGGACAAAGCTATTCATATGCAATGGCTCACTGACACAAACCAGCTCGGTGAGTTCTATAGCGAGGTGCGCAAGCTGATGGGTACATCCAACCATGCAAAGGTTCCTTTAAGGGCTCTAGATAGTAGGCACCTCTTAACAAGCAAGGAGGATGTACTAAGGCGCTGGGCAGAGCACTTCAATGCCCTGCTGAATGTGGATCGATCAGCAGATCTGCAAAGCATCGCTTTAATGCCTCAACTCCCTCTTGCCCTTGAGCTGGACGAGCCCCTATTGCGTGACGAGGTTGTTACTGCCATCAGACAGCAAAAAAATAAAAGGGCGGCTGGCGCTGACCTTATACCAGGAGAGCTGATCAAGTACGGTGGAGAGGATTTGCACACGTTGGTTTGGGAACTGTTTGTTCGTATGTGGGAGGAAGAGCGCGTTCCGGATAGCTTTAAAGTATCGCGCATAACTGCTCTCTATAAGAACAGGGGCGACCGATCTGACTGCGACTCCTACCGCGGTATTTCGCTCTTATCGGCCCCCGGAAAGGTCTTTGCTAGGGTACTCTTAAACCGCCTAAAGGACTTATCTGAAAAGATCCTGCCCGAAACTCAGTTTGGCTTTCGACCGGATCGAGGCACATGCGAAGCGATCTTCTCTGTGCGTCAACTACAAGAAAAGAGCAGAGAACAGGGTCGTCAGCTGTACCTCTGTTTTGTTGACCTGGAGAAGGCTTTTGACAGCGTGCCTCGCGAAGCCTTATGGTTGGTGTTACGGAAGCTCGGATGCACAGAAAAGTTTGTGGCGCTTCTTAGACTCCTGCATGACGACATGCAATGCTGCGTCACTGTAGATGGTGAACAGACGGGCTTCTTCCCCGTTACCTGTGGGGTGAAGCAAGGATGCGTCTTAGCGCCTACTCTGTTCGCCTTGTACTTTGCGGTCGTAGTTAGAGAGGTTCTACAAACTGTTTCCCAAGGAGTCCGCATCCGCTTCCGTACGGACGGCAGCCTTTTCAATTTGGCTAGACTTAAGGCTCGCACCAAAGTGTCGTATGCATTGATCACTGAGATCATTTATGCTGATGACTTGTGCTTCTTAGCAGAATCCCCAGACGGCCTGCAACAGCTGATGTCCGTTTTTCACCAAGCCTGCCGTAAATTCGGCCTGAAGATTAGTGTCAATAAGACGGAGGTGATGTCCCTGGACAGTCACGGTCACGAGACACTAACCATAAAGCTTGGTGAGGATGTGTTGAAGCAGGTGGATAAATTTCGCTATCTGGGGAACACTTTAACATCCAAGTGTGACCTTGATGATGAGATCAATAGCAGGGTCGGTGCCGCTGCGGCAGCATTTGGAAAGCTATATTCCAAGGTCTTCTGCTCACACGACCTTAAGTTGGCCACTAAAATCTCAGTTTACATGGCAATTGTGCTGCCAAGCCTCCTATACTCCTCCGAGTCGTGGTGTGTGTACCGCCGCCACATTCGCACTCTGGATCGCTTCCACCTTAAATGCCTTCGTGCCATCATGAAAATCAGATGGTCTGATAGAGTGCGAAATACCGAAGTCTTGCGACGTGCCAATGTTGGTGGCATTGAGACCTATTTAATGCGCCGGCAGCTTCGATGGTGCGGTCATGTATCACGCATGACGGAGGAAAGAGTGGCGAAGCGCATCTTCTTCTCTGAATTGCAGGATGGCAAGCGAAAGCATGGCGGACAACTCCTGCGGTACAAGGATGTCGTGAAACGACACATGAAGAGATGTGATATAGAGCCCTCTCAATGGGAGCGCTTGGCAGCACAGCGGCCAGAATGGCGCAGGATGGTGAACAGCAAAGTACGCGAGTTCGAGGATCAGCGTAAAGCTGACCTTGATTACAAACGCGACCAGTTGAAGGCCCGCCCACCTGCTGCCATAACCTATAATTATGAGAATGGCGTGCTTACGTGCCCTCAATGCGCAAGGAGTTTTGCCGCAAAGATAGGCTATATAAGCCATCTTCGAGCGCACGAGCGCCAAATCGACGGATAG
Protein
MTFGAWNVRTLLDRDGNACPERKTAIVARELHRYNVDVAALSETHLADEGELVEVGAGYTFFWKGTAASETRHSGVGFAIKNHLVKRLEEYPVHISDRVTTLRVHLDKDNYLNVISVYAPTLDKSDDIKDKFYGEVTLCLDSINAREQVLLLGDFNARVGRDYEAWPGVLGRHGVGNMNSNGQLLLSLCAQYGLAITNTMFRLAAKYKTTWMHPRSKHWHLIDYAIVRQRDFSQVQITRVMRGAHCWSDHRLIVTKLRLRLRRPRRSPMKKLASLDIEKLRDPEVRKNYAEVLSKKLLPVNETGDVDADWGALSSHIMDTASIALGRKCCRNEDWFDGNDEVLREALDKHRDLLRQHRRRKGSVAAVKASDLELRKLSRQIKDKWWQDKAIHMQWLTDTNQLGEFYSEVRKLMGTSNHAKVPLRALDSRHLLTSKEDVLRRWAEHFNALLNVDRSADLQSIALMPQLPLALELDEPLLRDEVVTAIRQQKNKRAAGADLIPGELIKYGGEDLHTLVWELFVRMWEEERVPDSFKVSRITALYKNRGDRSDCDSYRGISLLSAPGKVFARVLLNRLKDLSEKILPETQFGFRPDRGTCEAIFSVRQLQEKSREQGRQLYLCFVDLEKAFDSVPREALWLVLRKLGCTEKFVALLRLLHDDMQCCVTVDGEQTGFFPVTCGVKQGCVLAPTLFALYFAVVVREVLQTVSQGVRIRFRTDGSLFNLARLKARTKVSYALITEIIYADDLCFLAESPDGLQQLMSVFHQACRKFGLKISVNKTEVMSLDSHGHETLTIKLGEDVLKQVDKFRYLGNTLTSKCDLDDEINSRVGAAAAAFGKLYSKVFCSHDLKLATKISVYMAIVLPSLLYSSESWCVYRRHIRTLDRFHLKCLRAIMKIRWSDRVRNTEVLRRANVGGIETYLMRRQLRWCGHVSRMTEERVAKRIFFSELQDGKRKHGGQLLRYKDVVKRHMKRCDIEPSQWERLAAQRPEWRRMVNSKVREFEDQRKADLDYKRDQLKARPPAAITYNYENGVLTCPQCARSFAAKIGYISHLRAHERQIDG

Summary

EMBL
FJ265556    ADI61824.1    KU315381    AOE48155.1    AGCU01019305    AGCU01074235    + More
AGCU01078395    AGCU01195602    HACG01049402    HACG01049403    HACG01049405    HACG01049409    CEK96267.1    CEK96268.1    CEK96270.1    CEK96274.1    AGCU01099253    AAGJ04079542    AGCU01159961    GEEE01015618    JAP47607.1    LSMT01000835    PFX14128.1    AFYH01233515    LSMT01000050    PFX30432.1    AFYH01086022    RQTK01002506    RUS68506.1    GCES01103567    JAQ82755.1    GCES01145874    JAQ40448.1    LSMT01001244    PFX12648.1    LSMT01000478    PFX17357.1    CDMZ01001569    CEM34549.1    GEZM01098732    JAV53782.1    PDHN01000949    PGH37547.1    FJ265558    ADI61826.1    FN356221    CAX83710.1    BN000794    CAJ00236.1    GGMR01020071    MBY32690.1    GEZM01082534    GEZM01082533    JAV61334.1    GEZM01043748    JAV78864.1    HE799691    CCH14900.1    PYGN01000070    PSN55417.1    PYGN01000020    PSN57453.1    PYGN01000203    PSN51319.1    PYGN01000219    PSN50892.1    PYGN01000324    PSN48495.1    GAPW01000107    JAC13491.1    PYGN01001004    PSN38555.1    GEZM01039814    JAV81167.1    GFTR01008437    JAW07989.1    NIRI01001078    RJW67976.1    NIRI01001320    NIRI01000329    NIRI01000194    NIRI01000053    RJW67093.1    RJW71484.1    RJW72255.1    RJW73545.1    NIRI01002500    RJW61147.1    AJVK01001578    ABLF02039015    NIRI01001547    RJW66219.1    PYGN01000372    PSN47498.1    JARK01001422    EYC04705.1    NCKU01004395    RWS06003.1    PYGN01003402    PSN29545.1    NIRI01000312    RJW71849.1    GGFK01005184    MBW38505.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR013087   Znf_C2H2_type       
IPR005135   Endo/exonuclease/phosphatase       
IPR027124   Swc5/CFDP2       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0713839,     Score=88

Ontologies

Topology

Length:
1061
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.68519
Exp number, first 60 AAs:
8e-05
Total prob of N-in:
0.01136
outside
1  -  1061
 
 

Population Genetic Test Statistics

Pi
39.353035
Theta
65.973569
Tajima's D
-0.941952
CLR
782.312667
CSRT
0.149742512874356
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号