SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14061
Pre Gene Modal
BGIBMGA011228
Annotation
PREDICTED:_multidrug_resistance_protein_homolog_49-like_[Bombyx_mori]
Full name
Multidrug resistance protein 1       + More
Bile salt export pump      
Alternative Name
ATP-binding cassette sub-family B member 1
P-glycoprotein 1
ATP-binding cassette sub-family B member 11
Sister of P-glycoprotein
Location in the cell
Mitochondrial   Reliability : 1.408 PlasmaMembrane   Reliability : 1.881
 

Sequence

CDS
ATGGACGCTTTAGTGGAAGACTCCAGGGCGTTTGGATTGGCTAGCGTGGTGATCATGATAATGCAGATGACGACTGCCGCGTTTGCCGTCATCACGGCGAACTGGGCCGCTACTAGAATGGTAACAAGATTACGTCTTCGGATCCTGCGATCGGTATTAAGTCAAGAGATAGCATTTTTCGATACAAACACTACAATGAATTTCGCGTCGACGTTGACAGAGGACATGGAGAAGCTACAAGCGGGAGTGGGGGAGCATGTCGTGATGACGACATACTTAGCCGGGACGGTTGTGTGTGGCTCAGCTCTATCTCTTTCATACGGCTGGGAGCTGACATTAGCCGGGCTCTCTGTGGTTCCTGTTGCTATCCTTGTCGCAACAGTTGTTGCTAAGTACCAAACTAAATGTTCGACCAATGAGGTGGTGGCGTACGGAGTTGCCGGAAGAATAGTCGAGGAGGTATTGTCTGCTATTAGGACAGTAAGGGCTTATGGTGGAGAGGAACTTGAAGTTAAAAGGTACTCGGAAGCTCTAAAGCCAGCGGCCTCACACGCTCGTCGTCGTGGTCTCTGGGCTGGGGCGGGTTCAGGTCTTGGCTGGCTGCTCACCTACAGTCTAAACGCTATAGTCCTGGCTTACGGAACAGCTTTATGCGTCAGAGACTCGGATCTACCCCCAGAAGAACAGGATTACCATCCTGGCATCATGGTTACTATTCTGTTCTGCACTTTCGTGGCGGCGCAGAATATAGCGATGTGCAACCCTCATCTGGAGATATTCTCGACGGCGCGTGGAGCTGCCAAATCTCTATTCAAGCTAATCGAGAGGAAGTCCAATATCGACGCACTGGAGAACGTAGGAGTTAAGCCGGAGAGCTTCAGAGGCGATATCCAGTTCGAGAATCTGTACTTCAATTACCCTTCGAGACCCGACGTGAAGGTCCTAAGGGGGCTGACCCTCAAGATATCAGCGGGGGAGACAGTGGCCCTAGTCGGTTCCTCGGGCTGCGGTAAGTCGACGCTGCTGCAACTCCTGCAGAGGATGTACGAGCCCGAAACTGGACGAGTAGTTGTTGATGGCCATCCCCTAAACAAACTTCATCTGCACCATTTCAGGAAGAGCATAGGCGTGGTCGGCCAAGAACCAGTGCTCTTCTGCGGAACGATCAGAGAGAACATCACTTTCGGGATGGACGACGTCACAGAGGAACAGATGATCGAGGCAGCCAAAACTGCGCACGCGCATCAATTCATCACCAAACTCGCAAATGGCTATGACACCATGCTGGGAGAGCGCGGCGCTGCCCTATCTGGTGGACAGAAGCAGAGAATCGCGATAGCACGTGCCATAGTCAGACGTCCCGCTGTCTTGCTATTGGACGAGCCGACTTCTGCGCTAGACCCTGCTGCTGAGAAACAGGTCCAAGCAGCCCTGGACGCAGCTAGTAAAGGGCGCACCACACTCGTAGTCTCGCACAGACTATCGACCATTGCAAATGCTTCAAAGATCGTCTACATCGAACAAGGATCCGTGTTGGAGCAGGGAACTCATGCGGAACTGCTAGAGAAAAAAGGAAATTACTGGAAATTGCTCAACGAAGATCTGACTAGCAAGAGCATAGCAGCCACGTTATCAGCGGCCGGAAACGATGATGACGACGAGGTACTAGAGACTGTTGAAGAATGTCGTTTCCGAAGGTCCGTCAGCAGACAATCGATGCATCGAGAATCTATGAATCGGAACCACTTCGTGCGGGGCAGTCGCCGATTGAGGTCCATCTCATCGGCCCATCTGCCGGTCACCGCTGTGCCCGATCTCCTCAACTACGTGGAACCGGAAGAGACGGAAGACGAATCAGTCCCAGAGGTGTCCAGCTTGGCGCTGATGAAGCTGAACGCTCCGGAGTGGCCGCTGCTGATGGGCGGTGGCGTCGCCTCATTCTTGGTCGGTTCAACGATGCCGATATTCGCTTTGCTCTTCTCCAAATTATACGGGATGTTCGCCTCTGATGACACGGACGCGATCCTCGAGCAGTCGCAGCTGTATGCGGGACTCTTCGCCGGAGTCGCGGCCGCCTGCGGGATCGTCAACTTCCTCCAGACGTGGCTCCTGAGCAAGGCCGGCTCCAAGCTCACCGACAGACTGAGAGAGCACAGTTTCAGGAACTATTTGAAACAGGAGCAAGGCTGGTTTGACGAGCAAGCTAATTCTGTCGGGGCTCTCTGCGCCAGACTCTCCTCTGACTGCGCTGCTGTACAAGGAGCTACAGGTACCAAATTGGGGACGGTGCTCCAAGGCGTGAGCACGATGGTTATCGGTGTCGGACTGGCAATGGCATACTCGTGGAAGATGACATTAGTTAGCCTGACAAGCGTTCCTTGTGTCATGGGCGCCATCTATCTCGAAGGCTACGTGAACAAACGCACCGAAGAGAAACAGAAGAAAGCGATAGAGCACGCTTCGCGCGTCGCCACTGAAGCAGTACTGAACGTGCGCACCGTACAGAGCCTGGGTGTGGAGCTGACAGTCTTGGAGAAGTACGAACGCGCGCTGATGGGGGGTGGCGGTAGAGGGGGGAGTGGCGCAATGCGAGGCGCGGTGTACGGGGCGTGTCTGTGCGCACCTACGCTCGGTTACGCCGTGTCGTTAGCCTACGGAGGCTATCTCATCGCAACCGAAGGCCTGCACTATGAATACGCTATTCTGGTGTCCGAGGCGCTGATCTACGGAGCGTGGATGCTGGCTGAAGCGCTCTCATTCGCGCCAAACTTCGCCGCCGCCAAGCGCTCTGGGGCCAGGATCATTAATGCCCTAGCCAGGGAACCGAAGATCGTAACTGAACCAACAGCGAAGGATGAACCAGCATGGACCGCGAAAGGAGAGGTTAACTTCTCTGATTTACACTTCAACTATCCAACTCGGCCTTCAGTGCCGGTCCTGCGAGGCCTGAACCTTCAGCTCAAGGCCGGGCGCACTGTAGCGCTCGTCGGGGCCAGCGGCTGCGGGAAATCCACTCTGATGCACCTTATCATGAGGAGCTATGACCCTACTAAAGGCAAAGTTGAACTAGACGGGAGAGATATAAAGCGCGATCTTTCGCTGCCCAGTCTGAGATCGAACCTGGGACTCGTGCAACAAGAACCAGCGCTTTTCGAACGTTCAATCAGGGAAAATATTGCATACGGAGACAATTCACGGGATGTGACCTTGGAAGAGATTATAGACGCTGCGAAACAAGCGAACGTACACGGTTTTGTGGCGGGCTTACCTTTGGGCTACGAAACGAAGCTGGGACAAGGCGGAGCTGCTCTGTCCGGGGGACAGAAGCAGAGGATCGCGATCGCAAGGGCCTTGGTACGAAACCCGAGGGTTTTGCTACTGGACGAAGCCACATCAGCCTTGGATGCTTCCAGTGAAAAGGTGGTGCAAAGCGCTCTGGAAGTCGCCGCCAAAGATCGAACGACAATTATAATAGCTCATCGACTAGCTACGATCAGACATGCACACACGATATGCGTGGTCGAGAACGGAGTCATAGCCGAAAGCGGATCACATGACGAGCTGGTCCGAAAACGTGGACTTTACTGGGAATTATTGCAGCAGCAAGGACCCTCGGAAGCGAAAGCGTGA
Protein
MDALVEDSRAFGLASVVIMIMQMTTAAFAVITANWAATRMVTRLRLRILRSVLSQEIAFFDTNTTMNFASTLTEDMEKLQAGVGEHVVMTTYLAGTVVCGSALSLSYGWELTLAGLSVVPVAILVATVVAKYQTKCSTNEVVAYGVAGRIVEEVLSAIRTVRAYGGEELEVKRYSEALKPAASHARRRGLWAGAGSGLGWLLTYSLNAIVLAYGTALCVRDSDLPPEEQDYHPGIMVTILFCTFVAAQNIAMCNPHLEIFSTARGAAKSLFKLIERKSNIDALENVGVKPESFRGDIQFENLYFNYPSRPDVKVLRGLTLKISAGETVALVGSSGCGKSTLLQLLQRMYEPETGRVVVDGHPLNKLHLHHFRKSIGVVGQEPVLFCGTIRENITFGMDDVTEEQMIEAAKTAHAHQFITKLANGYDTMLGERGAALSGGQKQRIAIARAIVRRPAVLLLDEPTSALDPAAEKQVQAALDAASKGRTTLVVSHRLSTIANASKIVYIEQGSVLEQGTHAELLEKKGNYWKLLNEDLTSKSIAATLSAAGNDDDDEVLETVEECRFRRSVSRQSMHRESMNRNHFVRGSRRLRSISSAHLPVTAVPDLLNYVEPEETEDESVPEVSSLALMKLNAPEWPLLMGGGVASFLVGSTMPIFALLFSKLYGMFASDDTDAILEQSQLYAGLFAGVAAACGIVNFLQTWLLSKAGSKLTDRLREHSFRNYLKQEQGWFDEQANSVGALCARLSSDCAAVQGATGTKLGTVLQGVSTMVIGVGLAMAYSWKMTLVSLTSVPCVMGAIYLEGYVNKRTEEKQKKAIEHASRVATEAVLNVRTVQSLGVELTVLEKYERALMGGGGRGGSGAMRGAVYGACLCAPTLGYAVSLAYGGYLIATEGLHYEYAILVSEALIYGAWMLAEALSFAPNFAAAKRSGARIINALAREPKIVTEPTAKDEPAWTAKGEVNFSDLHFNYPTRPSVPVLRGLNLQLKAGRTVALVGASGCGKSTLMHLIMRSYDPTKGKVELDGRDIKRDLSLPSLRSNLGLVQQEPALFERSIRENIAYGDNSRDVTLEEIIDAAKQANVHGFVAGLPLGYETKLGQGGAALSGGQKQRIAIARALVRNPRVLLLDEATSALDASSEKVVQSALEVAAKDRTTIIIAHRLATIRHAHTICVVENGVIAESGSHDELVRKRGLYWELLQQQGPSEAKA

Summary

Catalytic Activity
ATP + H(2)O + xenobiotic(Side 1) = ADP + phosphate + xenobiotic(Side 2).
Subunit
Interacts with PSMB5. Finds in a complex with ABCB1, TFPI2 and PPP2R3C; leading to the dephosphorylation of ABCB1.
Interacts with HAX1.
Similarity
Belongs to the ABC transporter superfamily. ABCB family. Multidrug resistance exporter (TC 3.A.1.201) subfamily.
Keywords
3D-structure   Alternative splicing   ATP-binding   Cell membrane   Complete proteome   Glycoprotein   Membrane   Nucleotide-binding   Phosphoprotein   Polymorphism   Reference proteome   Repeat   Translocase   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Multidrug resistance protein 1
splice variant  In isoform 2.
sequence variant  In dbSNP:rs28381804.
EC Number
7.6.2.2
EMBL
BABH01009789    BABH01009790    AGBW02011924    OWR45901.1    KQ459593    KPI96347.1    + More
KZ149962    PZC76282.1    KQ460152    KPJ17387.1    GAIX01014073    JAA78487.1    BC130424    AAI30425.1    EU852583    CH236949    CH471091    ACF94687.1    EAL24173.1    EAW76942.1    M14758    M29447    M29424    M29425    M29426    M29427    M29428    M29429    M29430    M29431    M29432    M29433    M29434    M29435    M29436    M29437    M29438    M29439    M29440    M29441    M29442    M29443    M29444    M29445    M29446    AF016535    EU854148    AY910577    AK290159    AC002457    AC005068    M37724    M37725    X58723    AC188793    NBAG03000292    PNI46390.1    PNI46391.1    KB742957    EOB02509.1    AAKN02015613    AAKN02015614    AAKN02015615    AAKN02015616    PNI46392.1    ADON01060606    AAGW02061962    AAGW02061963    AB208970    BAD92207.1    CM004476    OCT75761.1    AAQR03012493    AAQR03012494    AAQR03012495    CM004478    OCT71794.1    LSMT01000057    PFX30016.1    RCHS01002978    RMX44531.1    CM012457    RVE58009.1    HAAD01005239    CDG71471.1    AEFK01112012    AEFK01112013    AEFK01112014    AEFK01112015    AEFK01112016    AEFK01112017    AEFK01112018    AEFK01112019    AAGW02004142    AAGW02004143    AAGW02004144    JH173922    GEBF01000776    EHB17920.1    JAO02857.1    KF601333    AHB33636.1    AANG04001482    KM232919    AKC42134.1    KP725019    ALU63321.1    KM232927    AKC42142.1    HG917100    CDM63421.1    KP725033    ALU63335.1    AF010597    AAC24753.1    AGTP01000190    AGTP01000191    MG254896    AVL26215.1    U69487    AABR07052465    AABR07052466    AABR07052467    AABR07052468    AABR07052469    AABR07052470    AABR07052471    AAPN01001001    AAPN01001002    AAPN01001003    AAPN01001004    AAPN01001005    AAPN01001006    AAPN01001007    AAPN01001008    AGCU01170418    AGCU01170419    AGCU01170420    AGCU01170421    AGCU01170422    AGCU01170423    AGCU01170424    AGCU01170425    AAKN02005698    AERX01005839    AERX01005840    GQ169125    ACU12846.1    MH420554    AYM45158.1    KN124048    KFO22476.1   
Pfam
PF00664   ABC_membrane        + More
PF00005   ABC_tran
Interpro
IPR003439   ABC_transporter-like        + More
IPR039421   Type_I_exporter       
IPR017871   ABC_transporter_CS       
IPR036640   ABC1_TM_sf       
IPR011527   ABC1_TM_dom       
IPR027417   P-loop_NTPase       
IPR003593   AAA+_ATPase       
IPR030275   MDR3       
IPR030258   MDR1       
IPR030278   BSEP       
SUPFAM
SSF90123   SSF90123        + More
SSF52540   SSF52540       
Gene 3D
PDB
6QEX     E-value=0,     Score=2058

Ontologies

Topology

Subcellular location
Cell membrane  
Membrane  
Length:
1209
Number of predicted TMHs:
9
Exp number of AAs in TMHs:
226.62869
Exp number, first 60 AAs:
23.04362
Total prob of N-in:
0.03635
POSSIBLE N-term signal
sequence
outside
1  -  14
TMhelix
15  -  37
inside
38  -  81
TMhelix
82  -  104
outside
105  -  107
TMhelix
108  -  130
inside
131  -  188
TMhelix
189  -  211
outside
212  -  637
TMhelix
638  -  660
inside
661  -  680
TMhelix
681  -  703
outside
704  -  783
TMhelix
784  -  806
inside
807  -  866
TMhelix
867  -  889
outside
890  -  898
TMhelix
899  -  921
inside
922  -  1209
 
 

Population Genetic Test Statistics

Pi
223.304007
Theta
151.128947
Tajima's D
1.585554
CLR
0.407243
CSRT
0.806509674516274
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号