SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14010
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.213 Nuclear   Reliability : 1.505
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCTTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGTTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGCCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGATGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGACCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGAAGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCTCGTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCFPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLAISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVADDFLHRFKLSDDIRELLRPKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVREARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPS

Summary

Subunit
The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
Similarity
Belongs to the histone H2A family.
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GEBQ01004157    JAT35820.1    GGMS01012398    MBY81601.1    KB632143    ERL89075.1    ABLF02022418    KQ973342    KXZ75569.1    GEBQ01003077    JAT36900.1    ABLF02010814    ABLF02010815    ABLF02037860    ABLF02037869    GBBI01004395    JAC14317.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02012584    ABLF02013765    ABLF02024884    GGMR01004661    MBY17280.1    KK115285    KFM64681.1    GALX01005299    JAB63167.1    GGMR01012189    MBY24808.1    GEZM01021868    JAV88847.1    GGMS01010725    MBY79928.1    ABLF02025082    ABLF02039175    ABLF02041809    ACPB03027378    JTDY01002082    KOB72150.1    ABLF02023911    KK118005    KFM71947.1    JTDY01011738    KOB53653.1    ABLF02065839    ABLF02003241    ABLF02003242    ABLF02025904    LBMM01018021    KMQ83899.1    GGMR01018716    MBY31335.1    ABLF02014934    ABLF02014939    ABLF02017810    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02009591    ABLF02009592    ABLF02009594    ABLF02066703    JTDY01000526    KOB76804.1    GGMS01006359    MBY75562.1    JTDY01005246    KOB67202.1    GGMR01016297    MBY28916.1    ABLF02042385    KK113281    KFM59799.1    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    JTDY01003188    KOB69997.1    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    KK119692    KFM76444.1    GGMS01000479    MBY69682.1    NEVH01023280    PNF18085.1    ABLF02003895    ABLF02006045    ABLF02035991    ABLF02066257    ABLF02037715    KQ971729    KYB24751.1    ACPB03022356    GGMS01001094    MBY70297.1    ABLF02007779    ABLF02007782    ABLF02050375    GGMR01016905    MBY29524.1    NEVH01021955    PNF19000.1    KK119261    KFM75202.1    ABLF02042518    ABLF02057746    GEDC01029594    JAS07704.1    ACPB03000870    GFTR01008257    JAW08169.1    ABLF02041767    GGMR01000226    MBY12845.1    MCIT02004487    PHT96476.1    ABLF02043963    ABLF02001804    ABLF02035179    ABLF02062794    GBGD01000415    JAC88474.1    DNOY01000259    HBE18313.1    GGMR01003864    MBY16483.1    NEVH01006736    PNF36716.1    GGMR01001088    MBY13707.1    GFTR01008261    JAW08165.1    LBMM01014024    KMQ85369.1    GBBI01004571    JAC14141.1    GGMS01006655    MBY75858.1    ABLF02030739    ABLF02019661    GGMR01015412    MBY28031.1    GGFK01009846    MBW43167.1    GGFK01009732    MBW43053.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF14291   DUF4371
PF05699   Dimer_Tnp_hAT
PF16211   Histone_H2A_C
PF00125   Histone
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR025398   DUF4371       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR006580   Znf_TTF       
IPR032458   Histone_H2A_CS       
IPR002119   Histone_H2A       
IPR032454   Histone_H2A_C       
IPR007125   Histone_H2A/H2B/H3       
IPR009072   Histone-fold       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF47113   SSF47113       
Gene 3D

Ontologies

Topology

Subcellular location
Chromosome  
Nucleus  
Length:
324
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0768
Exp number, first 60 AAs:
0.05637
Total prob of N-in:
0.07678
outside
1  -  324
 
 

Population Genetic Test Statistics

Pi
12.627802
Theta
19.776742
Tajima's D
1.244114
CLR
0.687765
CSRT
0.731713414329283
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号