SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13967
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.303 Nuclear   Reliability : 2.002
 

Sequence

CDS
ATGAAGTTGCACGAGGCCGATCACGCCGTGAGCCCTCTCGCGGATTCCGCCGTGCTCGTCGCTCCCGCGTCGTACACCGCAGCGTCCGCCATGCCTGCCACTCCCGCGTCGCCTATACTAGTGGGTAAAACTGCTGCGTCGTCCGCCGTGGCCGCTGCTCCCCTGGCGCGATCATCCGCGGGTTCCGTAGGGTCCGACGGACGTCCTGCATCTGCCCGTAGGTCGCCTGCTCCCGAGCCTGCTGCCTTCTCGTCCTCCGACTCTGACTCAGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAAAAGGGTAAGAAGCGCGCTGCGGAGTCCCGAGCTCCCGCGGCCGCTAAAATTATTAAAGCCGCGAACGCGTCGCGCCCTCGCCCTCCGACTCCCGTCGCTCCCCCTGCCCGTGCCACACCGTCGCCGCGTCCAGTGGCACAAAATAAAACTCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGACCGAGTTTCCCTGGCCCTTCAGGCCAAAAAAATTAATTTTATCAGCGCCCGTAACCTCGCGAACGGGATTCAAATTAAGTTAACGACACCCGATGACCATAGGGCCCTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTTCCACACTTATACGCTTCAGGAGGAGCGTGAACTTCGCGCGGTCATACGCGGCATCCCAAAGGAATTAGATGCCGATCTCATCAAGGCCGACCTTCTAGAACAAGGTTTGCCGGTCGATTCCGTGCACCGCATGCACACAGGACGCGGGAGGGAGCCATACAATATGGTTCTCGTCGCTCTCCAGCCTACCCCCGAGGGCAAGCAAATTTTCAACTCGATCAACTTTGATCGCGTTAATGCTTTGGGCGACGCCATTCGCGCCGCCTCCACTGCACAACACTTCATCGCCGTTGTGCAAGAATACGCTGACGTATACGCGTCGTTAAATACGTGGAACTCTCACACCTCAACCCCTAATGGCAGGCGCCTCGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTGACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATTCTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTAAATTCGATTGAAGTAGTTTCAGAGTTAGATTCAGACCATCGTCCCGTCATTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTTGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGATGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTGGTAACTATGCCCCCTCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAGCCCAGTGCATGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTTGGACGCGTTACTGCCCGTTACCTCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTTTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCTAACTGTATCTTTCCCACGGTGTGGAAAGAAGCGGACGTTATCGGCATACACAAACCCGGTAAACCAAAAAATCATCCGACGAGTTATCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGATTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAATACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTGCCGCAAGGCTCCGTTCTCTCACCGCTCCTATTTAGTTTATTTATTAATGATATTCCTCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCGGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACTCCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGTCAGGAAGGTTAAGTACCTGGGAGTCACCCTGGATGCATCTATGACATTCCGCCCACACATAAAAACAGTCCGCGACCGTGCCGCATTCATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCATCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTTGAATCAATCCAGAAGTACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCACCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGAGCAGGCTTAGGGACCCCAGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAG
Protein
MKLHEADHAVSPLADSAVLVAPASYTAASAMPATPASPILVGKTAASSAVAAAPLARSSAGSVGSDGRPASARRSPAPEPAAFSSSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKIIKAANASRPRPPTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVSLALQAKKINFISARNLANGIQIKLTTPDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDADLIKADLLEQGLPVDSVHRMHTGRGREPYNMVLVALQPTPEGKQIFNSINFDRVNALGDAIRAASTAQHFIAVVQEYADVYASLNTWNSHTSTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLNSIEVVSELDSDHRPVIMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQAQCMPSIQSADPVHVELVDSEVERRASLPPLDALLPVTSMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPTVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPIPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWVRKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPIMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDPSNRTRRTRQRGRRAT

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.052696,     Score=90

Ontologies

Topology

Length:
1140
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.80362
Exp number, first 60 AAs:
0.16076
Total prob of N-in:
0.00763
outside
1  -  1140
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号