SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13937
Annotation
PREDICTED:_uncharacterized_protein_LOC105842998_isoform_X1_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.715 Nuclear   Reliability : 2.217
 

Sequence

CDS
ATGGACCTTGAGTCTACCGCCTCCCACCCTAAAATTACACCCAATCCCATTCCATCTCCAGTACCTTCCACCTCCTATGCTGCAATAGCAGCAACACAAAAGCCATCGACCACGACTCATAGACCAGAGTTAACCAAGTCCCCTGCTCCAGGAGGGATCCGTGCTAACGAGGCACCCCGCCGCCACCCACCTATTATGGTGGAAGCGCTCCCGAACTGGTCTCGCCACATGGCGGCCATAAGGGAGCGCTTGGGGCGGGTCCCGTCTGTGCGACCCTATGGAACAGGGTTTAGATTTCTGCCCGCGTCGGCAGAAGAATACAGGGTGGTTCAAGCCTACCTCGCGGGGGCCTCCTCCGCGGACAGCGCCGTAAAGTGGTACTGTTATGCGTTAGAGGAGGACATCCCCGCGAGGGTGGCGATTCGAGGCCTGCCCGCTGACACCGACGCGGCAGAAATCATTAACGCCCTAAAGGAGCTGGGGTTCCCGGCCCGCTACGCCCGGTGCATAAGGGCAAAGAGAGGGAGGCCGGGTTGCGTATTTTTCGTAACCCTTGACCACCTCTCCAAGGAAGGCCTCGCCCGCTTGTACGCAGTTGAAGAACTGCTGTACCTGCCGGGGGTGTCAGTTGAGGGATGGCGTCCGAACCGAGGACCGGCGCAGTGCCATCGCTGCCAGGCCTTCGGACACGCCTCCACCAACTGCCACCGAGCGGTCCGCTGTGTGCGATGTGCGGGCGAGCACATCGTGGCGGACTGCCCGAGGCCAAGGGAGGGACCCCTCACCTGCGCCAACTGCGGGAAGGGCCACGCCGCTATTGATAAGCGGTGTGTGGTCTACCGCAGGAGGGCGCGGATGATGGGGGTCGCTATTCCTCCCCCCGTACCGCAAGCAGCGACGCGTGCCAGCCAAGCCCCTACCCCCGCTCCACGTCTCGGTCCACGCCCATCTCTGAAGGGTAAGGGCAAGGGGAAGACTTCTCAACCCCCCACTCTCCCTCCGGTTATAGAGCAACCTGCCACTGTGGAGGCCAACCCAACAGCGGCCACCCTGATGGCAGAAGCAAACCCGCAGCGAAAAGCTATAAAGCCGCGACCTGCCCCTCGTTCCAGTAATAAGGCAGCATCCAACTTACAAGCTGCCTTAACTACAACTACAACAAAAACTCAAAAAAAAAATAAGAAAAAAAAATAA
Protein
MDLESTASHPKITPNPIPSPVPSTSYAAIAATQKPSTTTHRPELTKSPAPGGIRANEAPRRHPPIMVEALPNWSRHMAAIRERLGRVPSVRPYGTGFRFLPASAEEYRVVQAYLAGASSADSAVKWYCYALEEDIPARVAIRGLPADTDAAEIINALKELGFPARYARCIRAKRGRPGCVFFVTLDHLSKEGLARLYAVEELLYLPGVSVEGWRPNRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPREGPLTCANCGKGHAAIDKRCVVYRRRARMMGVAIPPPVPQAATRASQAPTPAPRLGPRPSLKGKGKGKTSQPPTLPPVIEQPATVEANPTAATLMAEANPQRKAIKPRPAPRSSNKAASNLQAALTTTTTKTQKKNKKKK

Summary

Pfam
PF07530   PRE_C2HC        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
Interpro
IPR006579   Pre_C2HC_dom        + More
IPR035979   RBD_domain_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF54928   SSF54928        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
397
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00248
Exp number, first 60 AAs:
0.00098
Total prob of N-in:
0.02187
outside
1  -  397
 
 

Population Genetic Test Statistics

Pi
297.958048
Theta
176.720148
Tajima's D
2.326357
CLR
0
CSRT
0.929853507324634
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号