SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13932
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.914
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCATACTCTCAAATCGGATACGGTAGTAACTATGCCCCACCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCTGACGGTATATCTAACCGCGTTATTAAACTTATACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCAGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAG
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLAHTLKSDTVVTMPHLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDGISNRVIKLIPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNEGKLHTDFLPD

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973412    EFA12510.2    KQ973342    KXZ75569.1    GGMS01002955    MBY72158.1    GALX01005299    JAB63167.1    GGMS01006359    MBY75562.1    KQ971729    KYB24751.1    GGMR01015412    MBY28031.1    GGMR01006581    MBY19200.1    ABLF02042385    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    GFXV01007093    MBW18898.1    ABLF02040174    ABLF02040183    ABLF02055266    GBYB01008290    JAG78057.1    KK119261    KFM75202.1    GECU01013097    JAS94609.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMS01018022    MBY87225.1    GEZM01084970    JAV60359.1    NNAY01003095    OXU19992.1    GBBI01004395    JAC14317.1    ABLF02016634    GEZM01084969    JAV60363.1    GFTR01008038    JAW08388.1    GFXV01002840    MBW14645.1    GBBI01001646    JAC17066.1    AY060438    AAL25477.1    KK115285    KFM64681.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMS01000625    MBY69828.1    GGMR01018716    MBY31335.1    GGMR01000005    MBY12624.1    GFTR01008262    JAW08164.1    GGMR01000676    MBY13295.1    RPOV01000134    RPJ78669.1    KK118005    KFM71947.1    GGMR01011511    MBY24130.1    GGMR01013409    MBY26028.1    GGMR01019198    MBY31817.1    GFTR01008271    JAW08155.1    KK113281    KFM59799.1    GGMS01005381    MBY74584.1    GBBI01003810    JAC14902.1    ABLF02003242    ABLF02006260    ABLF02042516    NEVH01006736    PNF36716.1    GGMR01012443    MBY25062.1    ABLF02033757    GGMS01002786    MBY71989.1    GGMR01014053    MBY26672.1    S59870    AAB26437.2    GFTR01008246    JAW08180.1    GBBI01001699    JAC17013.1    GGMR01000086    MBY12705.1    ABLF02017543    ABLF02017549    ABLF02017551    ABLF02021996    GGMR01000226    MBY12845.1    ABLF02013806    ABLF02016612    GFTR01007929    JAW08497.1    KF280391    AIE77315.1    GEDC01029594    JAS07704.1    GGMS01015632    MBY84835.1    ABLF02032508    ABLF02034467   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
394
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.65355
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04811
outside
1  -  394
 
 

Population Genetic Test Statistics

Pi
126.946507
Theta
19.934041
Tajima's D
1.679786
CLR
0
CSRT
0.828058597070147
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号