SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13890
Annotation
retrovirus-related_gag-pol_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.942
 

Sequence

CDS
ATGACTTCTAATATTAATATTGATCGACTTACGGGTGATAACTATGACACTTGGAAGATTCACATGCGAGCTATTCTGAAGAAGAATGATTTGTGGGAATACGTATCAGGAAAAATACCGAAACCAATACATTCAGATTCTAAATATTCTGAATGGAATAAAATGGACGGAAAAGCCGAATCGGACATATTGTTAGCTGTCAGCCCGAGCGAGTTAATTGCACTGGATGGTTTAGACTCCTCCAAAGCAATATGGGACAAGTTGAAATCTATGTATGAGTCAAGCGGGCCAGCGCGAAAAGCGTTATTACTAAAGAGACTTGTATTAAATCATATGCCAGAAGATGGAGACCTACGAAAACATATTTCTGATTTTTTCGACTGTGTTAAGAAGCTTAAAGAAATCGGATTGATAGTGATAGATGAGTTGCTTGTTATTTTATTACTTTATAGTTTACCGGATTCGTTCTCAATGTTTCGAACAGCAATGGAATCGCGTGATGATTTACCATCAACTGATGTACTGAAAGTGAAGATTATCGAGGATTATGAAGGTCGGAAGAGTAAGATAATAGACCAGAGGGCTATGTTCGTCAAACGTACCAATATTAAATCAAATGCCAACCCGAAGAAGAACTTCGAACAGCACACAACTAAAAACATTGAGTGCTATCGTTGCGGTCGTCTTGGGCATATGGCGAGAGAGTACAGAACTAAAAACGTGAGTAAGCTTAAACAAAGCTCACATAAAGCAGAATGTAATAGTGATGATGAGCACAAGACAAATATGTTAGTAAGCACCACCAAAGAGGTGATGATAGCCGAGCAGAGAGCTCCTGTATGGTGTATTGACAGTGGATGTACGGGACATATGTGTAACAACAAACAATTGATTAAAGATTTTACTCGAGTTGATACAGACTTGAATTTGGCTAATGGTAAAACTACAAAAATTAGCGGCTCGGGAAAAGTCAGTATTATGGTAGACACAGGCAGCGAAAAGCGCCATGTTGATATTAAAAAAATGTTCTACGTGTCGGATCTACGAACTAATTTATTATCAGTTGCGAAGATGACAGATCACGGGTTTGAAGTTCGCTTCAATAAAAATTATGCAATTGTCATAGATGACAATAATAAGGTTCATATGCGAGCGGATCGAGTTGGTAACTTATACCACGTCCGAATGAGCCAAGATGATGTCAATAATGTTGAAATGGTGAAAAAACCTATAGATATGTGGCACGAGCGCCTCGGCCACCTTAACGAGCGTGATTTGAAGGCAATGGCGAAAAATGGCCTTGTCCATGGCCTATCATTGAAGGACAACGAAAAATTGTCAGAGTGTGAAATATGTATAAGTGAAAAACAGACATGCACGCCTTTTTCTAAAGGAAGCGAAGATCGTACAACTGAACTATTGGAGATCGTGCATACAGATGTGTGCGGACCAATGAGACAACAGTCTATGGGCGGTAAAAAGTACTTTGTCACGTTCATCGACGACAAATCAAGATGGTGTGAAGTATACTTTATTGCTAATAAAAGCGACGTACTTCAAGTTTTCAAAGATTACAAGGCTTACGTGGAAAAATTGACAGGAAATAAGATCAAAAATCTACAATCCGATAACGGTCGAGAATACATTAACAAAGACTTTGATGATTTCTTGAAGAAAGAAGGAATAAGACGGAGGTTGACGGCACCTTATACGCCTCAGCAGAACGGGATTTCGGAGAGAAAGAACAGGACATTGCTAGAGATGGCCCGTTGTATGATGCGTCAGGCGGGAAGCCCTCCTGTTTTTTGGGCTGAAGCAATTAATACTGCTAATTACATAAGGAACCGATGCCCAACTGCAGCTCTTGATGGTCAAATACCATTTACCCTGTGGACAGGAAAGAAACCTACCGTAATCTACATGCGCGTGTTTGGATCGAAAGCGTATTATAAAAACAAAGGAACGCAGAAGAGAAAATTCGAATCAAGTTCAGAGCTTGGAATATTTATGGGCTATGCTACTGAGTCTAAAGCTTACAGAATACATGATCCTAAGACTAGAAGGATCGTCATTTCTCGCGATGTGAAGTTTATGAACGAGACAGCATTCTGTCATGAGTATAAAGAAATACGAAATGATGAAGAAGAGAATTTTGATGATTCGAAAATAGTCGTTGAATTGAAAGGACATGATCAGAAGAAGGAAGATCGAAAAACAAACCCCATGAGAGGGAGAGGAAGACCAAGGATAGTTCGTACTGGCTTAGTGGGAAGACCGCGCAAAGAGTATAAACTAGCTACAAACAGTACAGAGAGTGAAACTGAATCGGAGTATGAAGTAGATAATGAAGAAACGACAGCTGGAATTGCGATTATTGAACCTAAAACATGGAAAGAAATAGAAAAGACTGATGACGAACCTGAATGGCGAAGGGCTTTAGAAGACGAGTATTTGGCACAATTAAAGAATGTTACATGGGAAATAGTCCCACGACCGAAAAATAGAAAAGTGATTGGTAGCAGATTTGTATTTCAAACAAAGAATACAGGGAAGAAAGTACGGCTTGTCGCAAAGGGATGTTCTCAAAGGCCAGGGGAGGATTTTTACGAAACCTCTTCTCCTGTTGTAAGGTCTTCATCTGTGAGACTCATAGCTGCAGTGTCAGCTGAGTTAGGATTAGAGATGCATCAAATGGATGTAGTAACAGCTTACTTAAATGGTACTCTCGAAGAAGATGTATTTATGGAAATACCAGATAAACTATCAGATGTCTTAGAAAGTGTACTAGCAAACCAGAATATTGGATCAAAAAGAGATATTATAAGAGATAAGAATATACTTCATACAGCTAAACGCTGGAACGAAGCATTGAATGAGTGTGAGAATAATGTGTGTTTGTTAAAGAAGTATTTGTATGGTTTGCGTCAATCAGGATTACAGTGGCATAAAAAGTTAGTAGGAAGGTTGAAGAATATTGGTTTTGAAGCGTTACCACAAGAACCTTGTGTGTTTGTTGCGCAAAGGGATGAAAAAATGATGTTAATTGCTATTTATGTAGATGACATTATCCTAGCGACTAATGATGAGGTGTGGTTGAATGATGTTAAGCGTCAGTTATCTAATGCCTTTGAAATGAAGGATATGGGAAAAATCAGTACTTGTTTGGGTATCGAATTTTCACGTGATAAGGAGCATAGAGTGCATTTAAAGCAAGGTGCGTATATAGATAAAGTATTAGAGCGTTATGGTATGAGTGATTGTAAACCTATATCAACACCTATGGATGTGAACGTTAAACTAGAAAAACCCAACAGTGTAAACAATGATGTTATGAGTCAGTACCCTTACCAGAACCTAATAGGTGCCCTTATGTATTTGGCTGTATCTACCAGACCGGATATAGCTTATACTGTAAATTATTTAAGCCAATTTAACACTAATTATGATGTACAGCATTGGAAGGCAGCTAAGCGAGTGTTGAGGTATTTGAAAGGTACATCAACTTTCGGCTTAATGTATGAGAGGACAGGTGTACCATTGTTTGGTGTAGTTGATGCAGACTGGGGTGCAAATACGATTGATCGAAGGTCATATTCCGGTTTTGCATTTATTTTAGCAGGTGCCCCAATTACCTGGGAAGCACGAAAACAGCGTACCGTTGCATTATCGAGCACAGAAGCCGAGTACTTGGCGCTTTCTGAAGCAACTAAGGAAGCTATGTATCTCAGAAATGTGATAAACAATGTTGGTGTAAAATGTGGTTGTGTGACATTATTTAATGACAACCAGGGTGCTATGAAGCTTGCATAG
Protein
MTSNINIDRLTGDNYDTWKIHMRAILKKNDLWEYVSGKIPKPIHSDSKYSEWNKMDGKAESDILLAVSPSELIALDGLDSSKAIWDKLKSMYESSGPARKALLLKRLVLNHMPEDGDLRKHISDFFDCVKKLKEIGLIVIDELLVILLLYSLPDSFSMFRTAMESRDDLPSTDVLKVKIIEDYEGRKSKIIDQRAMFVKRTNIKSNANPKKNFEQHTTKNIECYRCGRLGHMAREYRTKNVSKLKQSSHKAECNSDDEHKTNMLVSTTKEVMIAEQRAPVWCIDSGCTGHMCNNKQLIKDFTRVDTDLNLANGKTTKISGSGKVSIMVDTGSEKRHVDIKKMFYVSDLRTNLLSVAKMTDHGFEVRFNKNYAIVIDDNNKVHMRADRVGNLYHVRMSQDDVNNVEMVKKPIDMWHERLGHLNERDLKAMAKNGLVHGLSLKDNEKLSECEICISEKQTCTPFSKGSEDRTTELLEIVHTDVCGPMRQQSMGGKKYFVTFIDDKSRWCEVYFIANKSDVLQVFKDYKAYVEKLTGNKIKNLQSDNGREYINKDFDDFLKKEGIRRRLTAPYTPQQNGISERKNRTLLEMARCMMRQAGSPPVFWAEAINTANYIRNRCPTAALDGQIPFTLWTGKKPTVIYMRVFGSKAYYKNKGTQKRKFESSSELGIFMGYATESKAYRIHDPKTRRIVISRDVKFMNETAFCHEYKEIRNDEEENFDDSKIVVELKGHDQKKEDRKTNPMRGRGRPRIVRTGLVGRPRKEYKLATNSTESETESEYEVDNEETTAGIAIIEPKTWKEIEKTDDEPEWRRALEDEYLAQLKNVTWEIVPRPKNRKVIGSRFVFQTKNTGKKVRLVAKGCSQRPGEDFYETSSPVVRSSSVRLIAAVSAELGLEMHQMDVVTAYLNGTLEEDVFMEIPDKLSDVLESVLANQNIGSKRDIIRDKNILHTAKRWNEALNECENNVCLLKKYLYGLRQSGLQWHKKLVGRLKNIGFEALPQEPCVFVAQRDEKMMLIAIYVDDIILATNDEVWLNDVKRQLSNAFEMKDMGKISTCLGIEFSRDKEHRVHLKQGAYIDKVLERYGMSDCKPISTPMDVNVKLEKPNSVNNDVMSQYPYQNLIGALMYLAVSTRPDIAYTVNYLSQFNTNYDVQHWKAAKRVLRYLKGTSTFGLMYERTGVPLFGVVDADWGANTIDRRSYSGFAFILAGAPITWEARKQRTVALSSTEAEYLALSEATKEAMYLRNVINNVGVKCGCVTLFNDNQGAMKLA

Summary

EMBL
GAMC01007164    JAB99391.1    GAMC01002869    JAC03687.1    LBMM01008999    LBMM01007721    + More
KMQ88472.1    KMQ89488.1    GFTR01008771    JAW07655.1    JYDP01000350    KRZ01021.1    JYDN01000113    KRX56900.1    JYDM01000185    KRZ84108.1    LBMM01012368    KMQ86259.1    JYDJ01000518    KRX34768.1    GAKP01000358    JAC58594.1    LBMM01008805    KMQ88628.1    LBMM01008884    KMQ88558.1    LBMM01007580    KMQ89607.1    JYDH01000361    KRY26687.1    GAMC01013937    JAB92618.1    GAMC01015163    JAB91392.1    GBGD01000131    JAC88758.1    LBMM01010043    KMQ87706.1    GAMC01020352    JAB86203.1    FJ238509    ACI62137.1    GBXI01002679    JAD11613.1    GAMC01008929    JAB97626.1    LVZM01013697    OUC43997.1    GBXI01007143    JAD07149.1    GDHF01030254    JAI22060.1    GDHF01006360    JAI45954.1    GAMC01019998    JAB86557.1    GAMC01020355    JAB86200.1    GDHF01000873    JAI51441.1    GDHF01029905    JAI22409.1    GAMC01008189    JAB98366.1    GAMC01018338    JAB88217.1    JYDK01000327    KRX69779.1    GBXI01017107    JAC97184.1    KQ460297    KPJ16236.1    OIVN01002516    SPD04274.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    OIVN01003683    SPD12935.1    OIVN01002055    SPD00174.1    X07656    CAA30503.1    OIVN01006261    SPD29147.1    KQ459875    KPJ19636.1    GAMC01011082    JAB95473.1    JN402333    AFB73912.1    JN402332    AFB73911.1    NCKU01012701    RWS00004.1    KQ483417    KYP53032.1    LBMM01012669    KMQ86061.1    KQ483702    KYP42748.1    FJ544853    ACL97384.1    FJ544856    ACL97386.1    FJ544851    ACL97383.1    JXUM01155348    KQ572178    KXJ68066.1    JYDS01000421    KRZ07267.1    FJ544854    ACL97385.1    GDHC01011760    JAQ06869.1    JYDL01000068    KRX18751.1    LBMM01004924    KMQ91985.1    CM007899    OTG12557.1    AY009101    AAK12626.1    KA648745    AFP63374.1    CM007900    OTG08534.1    OIVN01000521    SPC81512.1    JXUM01136904    KQ568499    KXJ68982.1    GDUN01000215    JAN95704.1    GDUN01000217    JAN95702.1    ABLF02041793    CM003610    KYP61490.1    JYDP01000258    KRZ01816.1    KQ483456    KYP50361.1    KQ484324    KYP35753.1    GAMC01019995    JAB86560.1    OIVN01000269    SPC77391.1    CM003605    KYP71150.1    LBMM01012645    KMQ86082.1    GEZM01017328    JAV90763.1    CM003603    KYP77007.1    PSQE01000003    RHN67289.1    AC134048    DP000010    AAX92941.1    ABA91548.1    GEHC01000879    JAV46766.1    GEZM01017329    JAV90762.1    LBMM01012492    KMQ86193.1    AC006248    AAD17409.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF14244   Retrotran_gag_3
PF13961   DUF4219
PF00098   zf-CCHC
PF08534   Redoxin
PF00106   adh_short
PF00626   Gelsolin
PF08033   Sec23_BS
PF04500   FLYWCH
PF03159   XRN_N
PF17846   XRN_M
Interpro
IPR036397   RNaseH_sf        + More
IPR025724   GAG-pre-integrase_dom       
IPR013103   RVT_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR029472   Copia-like_N       
IPR025314   DUF4219       
IPR036875   Znf_CCHC_sf       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
IPR007123   Gelsolin-like_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR036180   Gelsolin-like_dom_sf       
IPR012990   Sec23_24_beta_S       
IPR007588   Znf_FLYWCH       
IPR004859   Put_53exo       
IPR041412   Xrn1_helical       
IPR027073   5_3_exoribonuclease       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF51735   SSF51735       
SSF52833   SSF52833       
SSF82754   SSF82754       
Gene 3D
PDB
4PA1     E-value=0.00689442,     Score=98

Ontologies

Topology

Length:
1269
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.34658999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.26884
outside
1  -  1269
 
 

Population Genetic Test Statistics

Pi
460.589444
Theta
223.070054
Tajima's D
3.734823
CLR
0.394152
CSRT
0.99630018499075
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号