SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13883
Pre Gene Modal
BGIBMGA011583
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.311 Nuclear   Reliability : 1.966
 

Sequence

CDS
ATGACTAAAGACATAGGACCTTCCGTTCGTGTCTGTTCTTTAAACATAGAAGGCATTACCCAGGCCAAAACTGAATGCATGCTCAGAATTGCCATAGATAATAAGATTGACATCATTCTGCTACAAGAGACCCACACTGCTGACCTCGCGCAACTCGCTAGAAGAGGAACGATTCCCGGCTTCCGCATGATCTGCGCTACATTCCATCCCCAATACGGCACTGCCACATACATACGAGAGGCCCTGCTGCCTTCAGCTTCAATTATATGCACCTCCACAGACACCGAAAACATCGCTATGTCAACGATCCAAGTGGGAGAAATGATAGTTTGTAACCTGTACAAACCTCCGAATAGCACATGGCCCCAACCAGGACTTCCAAACTATGGGCACCCGTCCATTGTAGTAGGCGACTTTAATAGCCACCACACCAGCTGGGGATATAAAAATAATGATGCTAACGGAGAATCTGTTGTCAAGTGGGCAGATGAATCCAGCTACTTCCTGGTCCACTGTAACAAAGACAAAGGCACCGTCAAATCCGCACGCTGGGGTCGTGAATATAACCTGGACCTCGCCTTCGTCTCCTTGGACTGCAAACGCAGACCCCTCCAGGTGAACAGAACTGTACTACAAGACTTTCCACACAGCCAACACCGCCCAGTTCTTCTCGACATCGGCCTGAAAATACTTATCATACAATCATATCCCGCACCACGCTGGAACTTCACTAAAGCTGACTGGGAACGCTATACGAAGACACTCGATGATTCCATTAGGTGGATACCACCCCTTCGGGAAAACTATGAAAGATTCCTAAAGCTAGTACTTTCCACAGCTAAAAAATGCATTCCAAGGGGATACCGGAAGCAATATATACCATGCTGGACTACCAAAACTGAAGCTCTATGGCAAGAGTTCATAACCACTAGCGACCGGAATGTTGCTCACGAACTCATTGAGTCTCTCAATGAAGCACGACAAGCTAAATGGGAAAGCACAGTCCAAGATATGAACTTCACACACTCAAGCCGTAAAGCCTGGCACCTACTTAAACGCTTCACTTCTGGAACTACCGGCCAGAAGAGTGAACCAAAAGTATGCCCCAGTAAAATTGCGGATAGGATTGTAAAACTGTCTAAAGCACCCAGCCACAAAAAACACACCCGTGAGGTGCGTAAGGATCTTAAATCTCTTAAGACAGACACTGCTTCAGACCCTTATTTTAGCCGTCCAGTTACAGCAGACGAGATAACTGCCAGTATCAGAGCTATTAAGGGAAACAAAGCTTGTGGAGAAGACAAAATCTTTCCAGAGTTCATAAAAGACAGTGGACCCCACACCCGTGTGTGGCTCGCGAAATTCCTCACGAATATCATTGACTCTGGAAAAATCCCACTTGCGATGAAACGGGCGAAGATAACGGCAATACTCAAACCTGGTAAGCCGGCTGACAGTGCAGATAGCTATCGCCCCATTGCCCTTTTGAGCGTAATGTATAAGCTACTTGAGCGAATCATACTTAACCGCATTTCACCAACTATAGAAAAACATATTCCTCAAGAGCAAGCTGGATTCCGTCCAGGACGCAGCTGCAGCGATCAAGTGTTAGCACTGACCACACTCTTGGAGAGGGGCTTTAACGAAAACCTCAAGTCGTCAACTGTATTCGTGGACCTAACAGCTGCTTACGACACAGTGTGGCGCCAGGGACTGCTGTACAAACTACTCAAGCTGATCCCCTGTATAAAGATCTACAATGTTATTGAGGACGCCCTTACCAACAGACCATTCCGTGTCCATCTGGGAGACAAGTCTAGCTTATCCAGGGTCCTGAACAACGGCCTCCCGCAGGGTTCAGTCCTCGCACCAACACTCTTCAACGTGTACACCCACGATGTGCCAGAGACGCTCTCCAGGAAATTTGCGTACGCCGACGATCTAGCTCTAGTCGCACAAGGCCGCAGTATAGAGACAACGGAATGTCACCTTGAAAACGACATGGCCACGCTTGATAACTACTTCATTCGATGTCGTTTGTGTCCAAATGCTTCCAAGACGGAAGTCTGCTGTTTCCACCTAAATAACCGACAGGCTAACAAGGAACCCATCTCTCTCTATAGATTATTTCACAAACTGTAA
Protein
MTKDIGPSVRVCSLNIEGITQAKTECMLRIAIDNKIDIILLQETHTADLAQLARRGTIPGFRMICATFHPQYGTATYIREALLPSASIICTSTDTENIAMSTIQVGEMIVCNLYKPPNSTWPQPGLPNYGHPSIVVGDFNSHHTSWGYKNNDANGESVVKWADESSYFLVHCNKDKGTVKSARWGREYNLDLAFVSLDCKRRPLQVNRTVLQDFPHSQHRPVLLDIGLKILIIQSYPAPRWNFTKADWERYTKTLDDSIRWIPPLRENYERFLKLVLSTAKKCIPRGYRKQYIPCWTTKTEALWQEFITTSDRNVAHELIESLNEARQAKWESTVQDMNFTHSSRKAWHLLKRFTSGTTGQKSEPKVCPSKIADRIVKLSKAPSHKKHTREVRKDLKSLKTDTASDPYFSRPVTADEITASIRAIKGNKACGEDKIFPEFIKDSGPHTRVWLAKFLTNIIDSGKIPLAMKRAKITAILKPGKPADSADSYRPIALLSVMYKLLERIILNRISPTIEKHIPQEQAGFRPGRSCSDQVLALTTLLERGFNENLKSSTVFVDLTAAYDTVWRQGLLYKLLKLIPCIKIYNVIEDALTNRPFRVHLGDKSSLSRVLNNGLPQGSVLAPTLFNVYTHDVPETLSRKFAYADDLALVAQGRSIETTECHLENDMATLDNYFIRCRLCPNASKTEVCCFHLNNRQANKEPISLYRLFHKL

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00514   Arm
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR011989   ARM-like       
IPR000225   Armadillo       
IPR028435   Plakophilin/d_Catenin       
IPR028446   JAC-1       
IPR016024   ARM-type_fold       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF48371   SSF48371       
SSF53098   SSF53098       
Gene 3D
PDB
6AR3     E-value=5.50878e-06,     Score=122

Ontologies

Topology

Length:
713
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01399
Exp number, first 60 AAs:
0.00149
Total prob of N-in:
0.00078
outside
1  -  713
 
 

Population Genetic Test Statistics

Pi
1.947572
Theta
3.789268
Tajima's D
0
CLR
0
CSRT
0.390830458477076
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号