SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13878
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.379 Nuclear   Reliability : 1.523
 

Sequence

CDS
ATGCTAGGCCATGTCCCCGGCGGTTCTCTGGCTGTTAAAGGGGAAGGCCCTCCAGAGGGGGGTACCGGAGGGTACCACCTTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCACGCTGCCCCGCGTATTCTGGGGGGGCAAAGAATGCCATGATGAAGGGGGCTGTGCGACGGACAGCGGAAAACCCGTCGAACCGAGGTGTGCCAGCGCTGGCTCGACGCGTTCTGCGCTCGTCAGCGACGGCGAAACAGTTGATCCGAAAGGGACAGCCGCCAAGAAGATCAGGCGGAAGAGGAAATCCTGGCGAGTTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCATCGTCCTCTGGTGCGGATGCCCCGCCGGAGAAAGTGCTGGTAGTCTCCGATGCGGCATCTGCTGCGGAGGAGATGCCGCCCCCTAAAGGAAGACCCGCCCGTAGAAGGGGCGCGCCGTCACCGGCGCCATCATCAGTGTCGATGTCTGTCGCCTCACTGGACGGGCAGACGACGGAGGAGGAAGAGGGTGGCCTTCAGGACCCTGCCTTGGTCATAGACAGGGCCATGAAGACCATCAAAACCTATGCGGCCAACGGCACCAAGACCAAAGCCGCTGGCCGTAAACTGCGAGAAGTGGTCACGCAAGTCTCGAAGGTTCTGCCTTCGGTTGCTTCTGCCAATGACCAGGTAGTGCAGCTGAGGGCGGAGAATTCGAGGCTTCGAGCACAGCTTCAAGCACAGCAGCAGCCCAATGATGGCGCAGCGACGCCTTGGGTCGCTGGAGCCCCTCGAGGTCCCCGTCCCCCGGCGCTGACTGGCGACCGATGGCCTGTGCTGCCGCCACCGCGTGTGGCACAGCAGAGGCCGCGTCTCCCGTCGCCGCGCTCTAGGGAGACGACCGCTGCCGAGCGACAGCAAGCACTCGCGGGGCCACGGATGTTGGCTCCGCTACAACCAACAAACTTCAGCCTGGAAGAGGTCATCAGCCGCACCATCCAGGCTGTAATAGAAAGGCTGGGCGGCAGGTTGGCGGCTCTCGAGGCGAAAGTCCCTACCTCGGCTGACGCTAGGCGGCCGGCGGTGTCGGGTGCTTTGGCCGCTCGTCCTGCTCCCGTACGGGCTCCAGTCACCAGGTCGGGCCCGGGACGGGATAGAACCAAGCGAGGGGGTCGCGCTAACGCGAAGCCCTCACTACAAGCACCCCAGTCCCGCCCGCTGCCTCCGCCCCCGTCAGATATGGATGAGGGGTGGAACGTGGTGGCCCGGCGGGGTACCAAAAAGGCCCCACCGGCAGCTCCTCAAACGAGTAGAGCGCCGGTGGCCATGGTGGCTCAGGGTGCACCCCAACAGGGTCGAGCGCCTGTAGCCGCCAAGAAAAACAAGAAGAAAAAGAAGTTGCCGCGCGCGCCTCGGTCGGCGGCAGTGGTTCTTACCCTACTGCCAGCCGCTGAAGCCAAGGGCATGACATACAGAGATGTCATTGCCCGGGCGCGTGCGGCAGTTGACCTGGGCGAGATCGGGGCGGAGGAGGAGGGCCTCCGCTGCAGGCAGACGGCCAACGGGGCCAAGCTGCTAGAATGTCCCGGTGCCGATAGTTCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTATGGTCCTGCCTGAGGAGGAGGTACGGGTGCACAGGCCGGTAAAAATGGCCGAATTAAGAGTAACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGACGGCGGCCGTCGCTGCCCAGGGCAAATGCGCACTGGAAAATGTCACAGTAGGCGAGCCGCACCGCGGTTATACCGGGGCCAGCTCGGTGTGGGTGCGTTGCCCGGTGGAAGCGGCCGCCTCCCTGGCTGCTCCTCCTCCCGGGAGACCTTCGGGAAATCCGGGCATGCTGCGCGTGGGCTGGATAGCGGCCCACGTGCACTTGCTTGAACCACGCGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGACACGGCCTCGCCAGGTGCACCAGCTCGGTTGACCGCAGTGGTCTGTGTTTCCGCTGCGGCCAGCCGGGACATAAAGCGGCGTCCTGCACGGCTGCCCCGCATTGCGCTCTGTGTGCTGCGGCCGGGCGCAGGGCAAGCCACCGAACGGGAGGCAAGGCGTGCTTTTCGTCCGGTAATAATACCGAACGCAACCGGCGCCGCAAGTCAAAGCGTCGGCAAAACAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGAAATCTGAATCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTTGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGTTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCAGGGCGTACTTCTCTCCAAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGTTCCCCCCGCTCGGACACTCGTGGTAGGCTGCTGGAGAGGTGGGCGAACGTGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTTGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTCCTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACAGGGACCACCCCCATGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTATGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCAGGGTGGTTCCGGGACACGATGTGTCGCATTTGTGATGCGTCGATGCCCCGGATTGGCCCTCGACTTCCTAATCGCCAAGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGACGCAATGATCCGGTTGCATTCGCGGCGGAAGAGGTCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGATGGATTTATCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGTGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTACGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGTCGGGTTTGGGGCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACCGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGTATTCTGGCAGCCCGCATCATCCAGCATCTGGCCGGGGTGGGACCCGATCTGTCGGCGGAACAGTATGGCTTCCGAGAGGGCCGCTCAACCGTAGATGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGCGGGGTGGCCCTGGCGGTATCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGATGGGATCGTGCACCGATTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTCTGTGGAATATCGGGTATGACTGGGTGCTAAGAGGTGCCCTCCTCCCGGGCCTGAGTGTAATCTGCTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGTTGGGGCCCCGGAGAGTGCCACCTATCGATGCTCAAATCGTGGTTGGAGGCGTCCGTATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGGTCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCAAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACTTTCGTGCCCGGGGCGTGGCGCGCCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGACTGGGCGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAGAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MLGHVPGGSLAVKGEGPPEGGTGGYHLRWRIPPCFHLGGSTLPRVFWGGKECHDEGGCATDSGKPVEPRCASAGSTRSALVSDGETVDPKGTAAKKIRRKRKSWRVSSREGVGEPASSSGADAPPEKVLVVSDAASAAEEMPPPKGRPARRRGAPSPAPSSVSMSVASLDGQTTEEEEGGLQDPALVIDRAMKTIKTYAANGTKTKAAGRKLREVVTQVSKVLPSVASANDQVVQLRAENSRLRAQLQAQQQPNDGAATPWVAGAPRGPRPPALTGDRWPVLPPPRVAQQRPRLPSPRSRETTAAERQQALAGPRMLAPLQPTNFSLEEVISRTIQAVIERLGGRLAALEAKVPTSADARRPAVSGALAARPAPVRAPVTRSGPGRDRTKRGGRANAKPSLQAPQSRPLPPPPSDMDEGWNVVARRGTKKAPPAAPQTSRAPVAMVAQGAPQQGRAPVAAKKNKKKKKLPRAPRSAAVVLTLLPAAEAKGMTYRDVIARARAAVDLGEIGAEEEGLRCRQTANGAKLLECPGADSSGIAERLAAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVTAAVAAQGKCALENVTVGEPHRGYTGASSVWVRCPVEAAASLAAPPPGRPSGNPGMLRVGWIAAHVHLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRASHRTGGKACFSSGNNTERNRRRKSKRRQNRRLARGALANAVIPAAAPVPEGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIRAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDTRGRLLERWANVAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHRDHPHGASRSFPKWALKRLNKELLMEASMVAAWAPMRPHPVEVEGEAGWFRDTMCRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAEEVRLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQERDGFIAPAMDAPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWGLALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLAGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHDGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLPLGPRRVPPIDAQIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADFRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWANRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVARIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=3.53711e-10,     Score=162

Ontologies

Topology

Length:
1782
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18274
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1782
 
 

Population Genetic Test Statistics

Pi
123.571091
Theta
112.477721
Tajima's D
0
CLR
132.756827
CSRT
0.368581570921454
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号