SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13877
Pre Gene Modal
BGIBMGA005007
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.29
 

Sequence

CDS
ATGTATTTTCTAAATTGTGAAAAGTTATTACCCCAGGAGGGTACCGCCTGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCGGTGGAAGCACGCTGCCCCACGTATTCTGGGGGGGGCAACAATTGCCAAGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGATGCGCTCCCTGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGAATCGGTTGCGATGAACCCCACCAAACCATCGTCGGGGAAAAAGAGGGGCCGAAGGAAGATCCCCGTAGCAACTTCCGACGACGGCGGTGCGTCATCCTCCAGCACCGAGGTGCCGGAAAAGACCATGGCCGTCGAGGAGGTGGCTCCGGTGATTTCGGGGCCTGCCGCGTCGAAAGACACGATGCCCGCACCCCAGTGGGCACCAGTAAGGAGGAGGGGCGCAGTGTCACCGGCGACGTCGGTGGAGTCGATGTCGACGTCGGCCGCGTCTCTGGCTAGCGGGGATGAGGCATTCCGCGACCTCGACCATGCCCTGGTCAATCTGGCTAAGTTGCTGTCGACCGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAGATTCTCCGGGAGGGAGCTGCTATGGTTAGGACGAAGCTGATCCCTACCATGTCCAAACTCGTAGCGCAGCTTGACTCCAGGGAGAGTCGTATTCTAGGGGACTCCCCAGCCTTGCGAGAGGGGACTCCCTTGTCACCGATGCCTGCGCTGGCACGCTCTGAGCCACCTGAGATGAGTGTGGCGGCGCTCATGCCAGCGCCCACTTCTGTGGCCCCTGTTCCGCGCGTGCCTACTCCCGCGCTCCCTCGCCCCCCTCGGAGGGTTGAGTTAAGGCCTGCGCCGCCTTCCCGGATATCGGCCGCCCCTGCATCCATACAGGCAGGAAGGTTAAGAACTGAGGACATCCGTTCGCCACTGGCGAGGATGGTAGACGAGTGGCCGGCGCTGCCACGGCCCAGGTCTTCGGAGCCGCCTCTTTCGCCCCCACGTGCTGCAGGGTCGCAGAGGCCTTATAACATGGCTGCTGAAATGGGGGAAGTGGATCACTCCCTCCCAAGCAGACAGGAAATGATGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAACACTTGGCTGGCCTTGAGGAGATGCTCCGCTCCTCGATTGGTTCCAGAGATTGCGTCCCTGTACCAACAGCCGCGACCGCCCCGCGGGACCAGGCCACCCAGCCGACCTCCACTTCTACCCCATCCGCGAGGGTGGCACGACGTGGAAGCCGGAATCAGCATAACAGAGGTGCGGGTGCCCAGAATCCCGCCCCACGATTCCAACCTCAGCCCCGTGTCCTTCCTCCCCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCACCAAAAGATTGCGACAGACAGCAGCTCTGGCAGCTCCCCAAGGGGGTCGAGCGCCGACTGCTGTTACCCGAAACACAGCGCTGGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCGGCCGCTAGCAAGACCAAAAACAAGAAGAAGAAGCCGCGCGCAGCGGGGTCGGCTGCCGTTGTAGTGACGTTGCTGCCGGCCGCCATCGAAAAGGGCCTCACGTATAATGAAGTTATGGCCCGGGCGCGCGCGGCCGTAAGCTTGGAAGAAATCGGAGCAGAGGAAGGCCTCCGCTTCCGGCACACAGCCAATGGGGCGAAGCTATTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCGTTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAGGAGGAGGTGGCAGCTGCGATAGCGGCCCAGGGGAGATGTGCCCCAGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGGGCCAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCGGCCACTTCCTTGGCTACTCCTCCACCGGGAAGATCGACGGGGGATCCGGGGAGATTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGAGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTATCGCATGGGTCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGTGGCCGGCCTCTGTTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGTTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCTCGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCAGGGTGGTTTCGGGACACGATGCGTCGCATCTGTGATGTGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGTCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCAGTTGCGTTCGCGGCGGCGGAGGCCCGGCTGCACGCCGCATTTCGCGTCGCGCAGAGGGCACTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGCCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACTCGCCGCCGGAATACGACAGCGAAGTCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGACGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGATGAGGCCGTCTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCATAATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTTGGGTGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGTCCGGGGCGTGGCGCGTCCCAGCCCAAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MYFLNCEKLLPQEGTACESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPMRSLIAGSMRSALASESVAMNPTKPSSGKKRGRRKIPVATSDDGGASSSSTEVPEKTMAVEEVAPVISGPAASKDTMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDEAFRDLDHALVNLAKLLSTVAAKGAEPGSSYRKILREGAAMVRTKLIPTMSKLVAQLDSRESRILGDSPALREGTPLSPMPALARSEPPEMSVAALMPAPTSVAPVPRVPTPALPRPPRRVELRPAPPSRISAAPASIQAGRLRTEDIRSPLARMVDEWPALPRPRSSEPPLSPPRAAGSQRPYNMAAEMGEVDHSLPSRQEMMACISRAVAVEVGKHLAGLEEMLRSSIGSRDCVPVPTAATAPRDQATQPTSTSTPSARVARRGSRNQHNRGAGAQNPAPRFQPQPRVLPPPPSSMDEGWTEVVKRGTKRLRQTAALAAPQGGRAPTAVTRNTALAAVAAPREGRAPAASKTKNKKKKPRAAGSAAVVVTLLPAAIEKGLTYNEVMARARAAVSLEEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGRCAPESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGEIGAIARRLAPRPVILAGDLNAKSIAWVSPRSDARGRLLERWANVAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADALGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHAAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIASALFPQEREGFVAPAMDSPPEYDSEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKDGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSDEAVSGGGVALAVSLDIANAFNTLPWSIIGGALERHGVPPTFAGWWVPTWRTDRSRVPDTVGSCTGSRSCAVFHRDDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGWPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRVRGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=5.03564e-10,     Score=161

Ontologies

GO

Topology

Length:
1732
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14632
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00010
outside
1  -  1732
 
 

Population Genetic Test Statistics

Pi
142.403953
Theta
161.687308
Tajima's D
1.598463
CLR
0.337409
CSRT
0.812009399530023
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号