SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13866
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.152
 

Sequence

CDS
ATGTTAGGCAGCTTATTGGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCTCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGGCACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGTCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGCTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCGTGGCGCGTCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAGTAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MLGSLLVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGRHVGRGPGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWALEAEALAADYQWRADLRARGVARPSHSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKVGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    KZ150386    PZC71062.1    RSAL01000481    RVE41577.1    D85594    BAA19776.1    LBMM01024063    KMQ82623.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01019839    KMQ83438.1    LBMM01019838    KMQ83439.1    LBMM01005733    KMQ91252.1    LBMM01004272    KMQ92618.1    LBMM01006671    KMQ90407.1    LBMM01008682    KMQ88705.1    LBMM01006063    KMQ90967.1    LBMM01006725    KMQ90373.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01003245    KMQ93755.1    LBMM01007036    KMQ90099.1    LBMM01005948    KMQ91066.1    LBMM01014132    KMQ85305.1    LBMM01003988    KMQ92922.1    LBMM01004505    KMQ92346.1    LBMM01008422    KMQ88894.1    LBMM01007425    KMQ89740.1    LBMM01015025    KMQ84953.1    LBMM01002480    KMQ94776.1    LBMM01014956    KMQ84982.1    LBMM01008448    KMQ88867.1    LBMM01013668    KMQ85535.1    LBMM01014122    KMQ85315.1    LBMM01012412    KMQ86235.1    LBMM01005465    KMQ91492.1    LBMM01021647    KMQ83033.1    LBMM01005474    KMQ91485.1    LBMM01008278    KMQ89009.1    LBMM01005845    KMQ91162.1    GGMR01000779    MBY13398.1    QOIP01000010    RLU18098.1    RSAL01003504    RVE40273.1    ABLF02011238    LBMM01006496    KMQ90570.1    GGMR01015354    MBY27973.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01014195    MBY26814.1    GGMR01015159    MBY27778.1    QOIP01000031    RLU14697.1    ABLF02034925    GFXV01001748    MBW13553.1    ABLF02005203    ABLF02041316    ABLF02041886    GFXV01002090    MBW13895.1    LBMM01004262    KMQ92649.1    GGFJ01001369    MBW50510.1    LBMM01004261    KMQ92650.1    GGFJ01001727    MBW50868.1    ABLF02004597    ABLF02041324    GGMR01012748    MBY25367.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGFJ01001370    MBW50511.1    GALA01001776    JAA93076.1    ABLF02004854    ABLF02041317    GGMR01006838    MBY19457.1    GALA01001777    JAA93075.1    GALA01000302    JAA94550.1    ABLF02041323    ABLF02041325    LBMM01004697    KMQ92167.1    GGFJ01001439    MBW50580.1    ABLF02023401    ABLF02029423    ABLF02060278   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF00098   zf-CCHC
PF01421   Reprolysin
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
467
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13373
Exp number, first 60 AAs:
0.02698
Total prob of N-in:
0.00254
outside
1  -  467
 
 

Population Genetic Test Statistics

Pi
42.725926
Theta
5.712213
Tajima's D
0.086232
CLR
137.73274
CSRT
0.411729413529324
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号