SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13857
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.422
 

Sequence

CDS
ATGGAGTGGACGCTTAAAGAAGACCGTGTTGCAATTATTGCGTCGCATCGTTGCGGTTACGCGCCAATTCAAATTTTTAACATACTGAAAATTTTGAATATAACCAAAAGATTCGTTTATCGTACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAGGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGATTCCAGCAGTTATAAAAGCTGTGAAGGCGCGAATTCAAAGAAATCCCAAACAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCATGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGCCTACCGTCGAGTTCGGGCATTTCCTGGACGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGAACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAATGCGGCCGGCCTCTGTCTGATGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGATCATTCCCTAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTGGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCCTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAATGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGGAGAGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCGGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTTGCTCCTGCTATGGACGCGCCGCCGGAATACGACGGCGAAGCCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGTCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTATAACTCCTGCCTCGAGTCGGGACCGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGTATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCCGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCTTTTAACACCCTGCCCTGGTCCGTGATAAGGGGAGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTACTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGAGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAAAATCTGGTCCCTCGTCTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACGTTGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAAGTGGCGGGCTGACCTTCGTGCACGGGGCGTGGCACGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCTGACGGCAGAGTGCCACCATTGTGGTTGCGGCTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCAATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGCGAGACGCGCAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATTTCGCCCAAGCCCTGGCCCTCTAA
Protein
MEWTLKEDRVAIIASHRCGYAPIQIFNILKILNITKRFVYRTIKRYNEDSSVDDRSRSGRPRSVRIPAVIKAVKARIQRNPKQVHFCEKGVKTNAVVYQNTVMTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPPTVEFGHFLDGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSNARGRLLERWANAAGLCLMNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKDQHMESLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPRQLRDIVSALFPQEREGFVAPAMDAPPEYDGEAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGPFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIRGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGESFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYKWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAELTAECHHCGCGLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADFAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01008448    KMQ88867.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01015025    KMQ84953.1    LBMM01003988    KMQ92922.1    RSAL01003504    RVE40273.1    LBMM01008422    KMQ88894.1    LBMM01012412    KMQ86235.1    LBMM01007425    KMQ89740.1    LBMM01014122    KMQ85315.1    LBMM01008278    KMQ89009.1    LBMM01005474    KMQ91485.1    LBMM01004262    KMQ92649.1    LBMM01015285    KMQ84870.1    GGMR01015159    MBY27778.1    ABLF02034925    LBMM01002480    KMQ94776.1    ABLF02011238    LBMM01005465    KMQ91492.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01006838    MBY19457.1    GFXV01002090    MBW13895.1    GALA01001777    JAA93075.1    LBMM01004261    KMQ92650.1    GGMR01012748    MBY25367.1    ABLF02011183    ABLF02041884    ABLF02041886    ABLF02018942    ABLF02041885    KU543683    AMS38371.1    ABLF02018808    KQ971309    EEZ99146.1    ABLF02004854    ABLF02041317    GGFJ01001369    MBW50510.1    GFXV01003903    MBW15708.1    GGFJ01001727    MBW50868.1    GGFJ01001370    MBW50511.1    ABLF02023257    GALA01001776    JAA93076.1    GGFL01004044    MBW68222.1    GGMR01019493    MBY32112.1    GGMR01004600    MBY17219.1    AB593325    BAK38646.1    GALA01000302    JAA94550.1    GAKP01002292    JAC56660.1    AB593327    BAK38648.1    GGFJ01001439    MBW50580.1    AB090815    BAC57906.1    GAPW01000192    JAC13406.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    ABLF02007989    ABLF02041557    ABLF02014650    GEHC01000915    JAV46730.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    AB593321    BAK38639.1    GGFK01005660    MBW38981.1    KQ972226    KYB24577.1    KQ971388    KYB24913.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=5.71595e-09,     Score=150

Ontologies

Topology

Length:
1123
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.967649999999997
Exp number, first 60 AAs:
0.814
Total prob of N-in:
0.03644
outside
1  -  1123
 
 

Population Genetic Test Statistics

Pi
123.107729
Theta
2.609199
Tajima's D
0
CLR
0.490215
CSRT
0.403229838508075
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号