SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13841
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.431 Nuclear   Reliability : 1.784
 

Sequence

CDS
ATGAAGTCGACAAAAAAAAAGAAAAGGGTTTCACAGGCGGTTCCCCATTCCACATTTAATGTGGATTTCAGCAATGTCAGGGGCCTACATAGCAACCTTGACGCCGTACACCACCACCTTGAGACGGCGCAGCCTGCCCTGCTTTTTTTAACGGAGACGCAGATATCTGCTCCGGATGATACCTCATACCTTGAGTATCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTATGCGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAACAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCCGTAGCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGTTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAAGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACAGATCCGGCCGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCGTCTGATCACTGCCTTATTCGTGCTGCCGTACCACTCTCTCGTCCTGATCGTCGAACGACGACCGGGTATCGAAGAGTTTGGCGGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGACTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGAGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCGGGATCCTAACATCTCAGGGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCGGAGCACGTTGCTAGAGTTGGCGAGCGATTGAAGAGCTATCCCGCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTTTGCAGGTCTAGTCTCCCACCACTGCGCAAGTCCGATGACAATCTGGCCCACAGCGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAGCATCCCCCGGTGTGATAGCTCCCTGCCGGATATCTGCTTCACACAGTGTGCAGTCAGGCGGGAGCTCCGACTCCTGGACGTTCATAAGTCGAGTGGGCCAGACGGCATCCCCGCAGTGGTTTTGAAAACGTGCGCCCCTGAGCTGACACCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGGATTAACAAGGTTCCGTCTTCATGGAAGACTGCTCATGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATTATAAATACACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTATGATAGCACGGGGGATGCGCGATATATCGGCCATCAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTGCTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCATGGAGTACTGCTCTCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGACCCTCTGGGTTTGCGGAGGGACTTCGGTTCCCTCTGTATTTTATACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCGCGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MKSTKKKKRVSQAVPHSTFNVDFSNVRGLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGRSRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAAVPLSRPDRRTTTGYRRVWRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRRDPNISGERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPAGSRAFWSLAKAAEGNFCRSSLPPLRKSDDNLAHSAKEKADLLVKLFASNSTVDDGGATPPSIPRCDSSLPDICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYWINKVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINTQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAMIARGMRDISAISLSRSVVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRCFTPGQRLLLYKAQVRPRMEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLDPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSAVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

GO

Topology

Length:
897
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00359
Exp number, first 60 AAs:
0.00042
Total prob of N-in:
0.00064
outside
1  -  897
 
 

Population Genetic Test Statistics

Pi
150.0858
Theta
20.894956
Tajima's D
1.989637
CLR
0.001206
CSRT
0.878506074696265
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号