SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13839
Annotation
PREDICTED:_uncharacterized_protein_LOC105841996_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.968 Nuclear   Reliability : 1.326
 

Sequence

CDS
ATGGCCCTGTACGGTGCTCCCGTGTGGTCGCCCGCACTCTCCGCGAGAAACGCGGCTCTGCTGCATAGAGCTCAGCGGGCGCTTGCGGTGAGGGTCATCAGGGGGTACCGCACCATCTCTCAAGATGTGGCCTGCGCTCTCGCCGGATCCCTACCCTGGGACCTCGAGGCCGAAATCTTGGCTGCGGTATATCGGCGTAAGGCGCAGGCCTTGAGTCGGGGGCGGTCGCCCGGCCCGTCGGCTGTCGGTCGGTGGAAGCGTGCTGCGCGTCATGTAGCATACGCTAAGTGGAGAGAGCGATTGCTGAAAGAACTTGGCCAAACTTCGGCCACCCGCCGGCGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTCGGATCGGCGTCACGGCGTACTCTCCTTTCACCTTGCGCAGGTCCTCTCGGGACATGGCTGTTTCGGGAGGTACCTGTGGAAGGTCTGCAGGAGAGAGCCACACCCGGGCTGCCACCAGTGCGGGCACCCGGACGATGACGCGCAGCACGCGCTCGAAACGTGCCCGCGTTGGGAGCACTCGCGGCGAGATCTCGTCGCGGTGCTGGGGAGAAACCTCTCCCTGCGGGCTGTCGTCGCCCGCATGTTAGAGGATCAGGGCTCGTGGGAGGCCATGGCCAGGTTTTGTGACCTGGTAATGGCGTCCCGTGAGGCTGAGGAGCGTGAAAGGGAGTGGGATCCCTCTTCAGCACCTCAGCGCAGAAGGCGGGATGGCCGGCGCGGGCGTGAAGCTCCCGCTCAGCCCCCGTAG
Protein
MALYGAPVWSPALSARNAALLHRAQRALAVRVIRGYRTISQDVACALAGSLPWDLEAEILAAVYRRKAQALSRGRSPGPSAVGRWKRAARHVAYAKWRERLLKELGQTSATRRRTLEALVPVLEAWSDRRHGVLSFHLAQVLSGHGCFGRYLWKVCRREPHPGCHQCGHPDDDAQHALETCPRWEHSRRDLVAVLGRNLSLRAVVARMLEDQGSWEAMARFCDLVMASREAEEREREWDPSSAPQRRRRDGRRGREAPAQPP

Summary

EMBL
D85594    BAA19776.1    KZ150308    PZC71477.1    RSAL01000481    RVE41577.1    + More
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078935    BAC06462.1    AB078929    BAC06452.1    AB126050    BAD86650.1    LBMM01009501    KMQ88083.1    KZ150386    PZC71062.1    KZ149950    PZC76665.1    KZ149896    PZC78733.1    AB090825    BAC57926.1    LBMM01012027    KMQ86470.1    ODYU01009945    SOQ54696.1    RSAL01000109    RVE47213.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    QOIP01000010    RLU18098.1    QOIP01000009    RLU18544.1    LBMM01008861    KMQ88580.1    LBMM01016102    KMQ84557.1    LBMM01006538    KMQ90523.1    RSAL01003504    RVE40273.1    QOIP01000031    RLU14697.1    LBMM01009494    KMQ88097.1    LBMM01014132    KMQ85305.1    KQ460685    KPJ12887.1    LBMM01003679    KMQ93242.1    LBMM01005733    KMQ91252.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01006110    KMQ90925.1    GGMR01015518    MBY28137.1    LBMM01004505    KMQ92346.1    LBMM01006954    KMQ90166.1    GDHF01014602    JAI37712.1    LBMM01006909    KMQ90209.1    LBMM01015018    KMQ84954.1    LBMM01006725    KMQ90373.1    ABLF02023401    ABLF02029423    ABLF02060278    ABLF02009991    ABLF02009992    ABLF02054952    ABLF02016340    LBMM01008349    KMQ88951.1    GFXV01002242    MBW14047.1    KU543679    AMS38363.1    GDAI01000748    JAI16855.1    LBMM01011877    KMQ86578.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01006977    MBY19596.1    LBMM01012595    KMQ86127.1    GBHO01002982    JAG40622.1    ABLF02018942    ABLF02041885    GGMR01014918    MBY27537.1    LBMM01006657    KMQ90417.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    GALX01004785    JAB63681.1    LBMM01007638    KMQ89555.1    LBMM01019839    KMQ83438.1    LBMM01005216    KMQ91703.1    LBMM01019838    KMQ83439.1    ABLF02011183    ABLF02041884    LBMM01006671    KMQ90407.1    GGMS01001211    MBY70414.1    LBMM01002052    KMQ95336.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    LBMM01015025    KMQ84953.1    CH963857    KRF98317.1    ABLF02016435    ABLF02016436    ABLF02064751    GAPW01002021    JAC11577.1    AAZX01012143    AAZX01012194    GALA01001066    JAA93786.1    LBMM01003245    KMQ93755.1    GAPW01002123    JAC11475.1    ABLF02041886    AB593322    BAK38641.1    GFXV01003903    MBW15708.1    ABLF02006132    GEHC01000964    JAV46681.1    ABLF02011238    ABLF02017307    GAPW01002043    JAC11555.1    KQ971310    KYB29500.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF01421   Reprolysin
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
262
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01843
Exp number, first 60 AAs:
0.00703
Total prob of N-in:
0.01411
outside
1  -  262
 
 

Population Genetic Test Statistics

Pi
59.783246
Theta
48.723775
Tajima's D
0.557075
CLR
0
CSRT
0.530623468826559
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号