Gene

KWMTBOMO13814

Pre Gene Modal

BGIBMGA011551

Annotation

PREDICTED:_beta-secretase_1-like_[Bombyx_mori]

Location

Bomo_Chr23(+):10029100-10036300      View in EpiBrowser

Full name

Beta-secretase 1      

Alternative Name

Beta-site amyloid precursor protein cleaving enzyme 1
Memapsin-2
Membrane-associated aspartic protease 2

Location in the cell

Extracellular   Reliability : 1.726 PlasmaMembrane   Reliability : 1.508

CDS

ATGGCGAAGCTGTTAATAATTTTTCTCTATTGTATTTGTGCGAATGGAGAACAGTTTAATTTGCAAGGAGATGCCGGCCTTGCCTATTCTGTTGAGGTAATCATGGGACATCCACATCAAAAGATAAACCTTTTAATTGATACTGGTAGCACAACATTAGCTGTTGCTTCATATTCAAGACAAGATAGTGATAAATACTTTGATGCAAACAATTCTAGCAGCATTTATGACAGTGGGAAAAAGGTGCAGGCAACATACTTTGAAGGCAAATGGATTGGCCGTTTAGTCTCAGATTATATACAGCTCCCATCTATGCCATTGGTGCCAGAAGTCAGGACTGATATGGCACTTATTATGGAAAGCCACAATTTTTTTATGAATGGCTCACAATGGCAGGGTCTTCTAGGACTCGCATATCTACCAGTTGGAGCAAGGGGAGCAGATGTAATTGTGGAATCATGGTTAGATTCCCTTGACCGTACTTTGACTAGACCTGTATCATTTCAACTCAAACTTTGTGCTACATTAAGTACACAAAATGCGACGCACTATGGAAACTTTCAGATACTAGATGGTAAACAAAAAAATGAAAATTTAAACAAATCATACCGAACAACTATAATACAAAAAAGGTGGTATGAAGTTGGTGTTTTATCTGTGAGGGTTATGAGACATGTAAATAAATCAAGCAATCCTCCAGACATAGATGAACATATGTGTCAAACGCTTAATAAAATAAAGGCTATAGTTGATAGCGGAACAACAAATATAAGGTTACCTAATTGTTATTTTAGGCAGATTGTTGATGATTTGAGAAGCGCAGCACAGACTTCTAATATGTTAATTACGGATGACTTTTGGTATGCGGGAGAGACTGGATGTTGGCCAGAGCCTCAAGACTGGTCACTACCCTGGGTAGCGGTAGACCTACTTAGCTACGAAGCAGATAACCAGTACTTTACGTTAATGCTGTCGCCGCAGAATTATATGAGAGTCGTGGCAGCACAGAACAGCAGCGGTGAAAGTGGGACCGTATCAGAATACTGTTACAAATTGGGTTTTGAAAAAGGCGGAGATGAAACTGTACTCGGCTATACAGCCATGGAAGGATTTCAGATCAGCCGGTTGGATCGGCTGGCAGACCTCGGACTGTGGTCCAAACACTAA

Protein

MAKLLIIFLYCICANGEQFNLQGDAGLAYSVEVIMGHPHQKINLLIDTGSTTLAVASYSRQDSDKYFDANNSSSIYDSGKKVQATYFEGKWIGRLVSDYIQLPSMPLVPEVRTDMALIMESHNFFMNGSQWQGLLGLAYLPVGARGADVIVESWLDSLDRTLTRPVSFQLKLCATLSTQNATHYGNFQILDGKQKNENLNKSYRTTIIQKRWYEVGVLSVRVMRHVNKSSNPPDIDEHMCQTLNKIKAIVDSGTTNIRLPNCYFRQIVDDLRSAAQTSNMLITDDFWYAGETGCWPEPQDWSLPWVAVDLLSYEADNQYFTLMLSPQNYMRVVAAQNSSGESGTVSEYCYKLGFEKGGDETVLGYTAMEGFQISRLDRLADLGLWSKH

Description

Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase. Cleaves APP with much more catalytic efficiency than for the wild-type.

Catalytic Activity

Broad endopeptidase specificity. Cleaves Glu-Val-Asn-Leu-|-Asp-Ala-Glu-Phe in the Swedish variant of Alzheimer's amyloid precursor protein.

Subunit

Monomer. Interacts (via DXXLL motif) with GGA1, GGA2 and GGA3 (via their VHS domain); the interaction highly increases when BACE1 is phosphorylated at Ser-498. Interacts with RTN3 and RTN4. Interacts with SNX6. Interacts with PCSK9. Interacts with NAT8 and NAT8B. Interacts with BIN1 (By similarity).

Similarity

Belongs to the peptidase A1 family.

Keywords

Acetylation   Aspartyl protease   Cell membrane   Complete proteome   Cytoplasmic vesicle   Disulfide bond   Endoplasmic reticulum   Endosome   Glycoprotein   Golgi apparatus   Hydrolase   Isopeptide bond   Lipoprotein   Lysosome   Membrane   Palmitate   Phosphoprotein   Protease   Reference proteome   Signal   Transmembrane   Transmembrane helix   Ubl conjugation   Zymogen  

Feature

chain  Beta-secretase 1

Uniprot

A0A0N0P9Z3   A0A194QP43   A0A2W1BNY8   A0A2H1VDQ6   A0A3S2NRM5   A0A2A4J4D8   + More
A0A1E1WAL9   A0A2P8XBR8   A0A2J7QRA6   A0A067QVR7   A0A2J7QRA2   A0A3L8S139   U3JTE5   W5MGP0   A0A3M0IYY5   A0A218UQP8   H2T442   A0A3Q2D4W4   H3DA27   A0A0Q3T1R0   F1N916   A0A226PMM9   A0A1V4J835   A0A3B3S824   A0A3N0Z3Y5   A0A1A8PDI3   A0A1A8I891   A0A1A8CH12   A0A1A8U632   A0A3P9NNE7   A0A1A8PRS4   A0A1A8G7W0   A0A3B3VJ97   A0A1A8MPD5   A0A3P9NNH4   A0A087XNU3   A0A3B3X3P6   A0A3B5QZG1   A0A0F8AXU5   A0A3B4BPE8   A0A2I4CNB6   A0A3B3BIR4   A0A151MVW4   G3NRK5   A0A3P8WBP3   A0A3Q0RU93   A0A3B1IHI0   A0A3B4X2Z0   H3BFZ7   A0A3Q0S6U0   A0A098LWN5   A0A1U7S779   I3KIR1   A0A3B5ATN3   A0A3Q1JPI7   A0A3Q3F7V2   A0A3P8XV70   A0A3P8PH74   A0A3P9BCK9   A0A3Q3BRF1   A0A3B4UH38   L5M0R1   A0A3Q3S981   A0A3B4UEA6   A0A3P9K9I4   A0A1W4YWI6   A0A3B4F5A5   A0A3Q3CER0   A0A060W7N0   K1PZA2   A0A2D0T8P4   G1PAB0   A0A3B3H7C2   A0A3P9HRM4   Q6NZT7   A0A3Q2QT07   A0A0A1WDW4   A0A1L8FFW8   A0A3Q1F609   A0A2U9B5T5   A0A3Q1LZR2   A0A1U7RGL7   A0A146W007   A0A098LX26   A0A3B4A1C3   Q8BQY4   A0A091DLE0   A0A287DDZ1   A0A2K6G6V5   A0A1S3NQS5   A0A1A6GT58   H0WUA0   V6F9A9   Q2HJ40   A0A1S3SYP0   A0A2K6G6W1   A0A060W0U5   A0A3P8U9P1  

EC Number

3.4.23.46

Pubmed

26354079    28756777    29403074    24845553    30282656    21551351    + More
15496914    15592404    24621616    29240929    23542700    25835551    29451363    22293439    24487278    25329095    9215903    25449103    25186727    25069045    17554307    24755649    22992520    21993624    27762356    19393038    28071753    25463417    10349636    11042159    11076861    11217851    12466851    16141073   

EMBL

KQ459037    KPJ04306.1    KQ461195    KPJ06745.1    KZ149950    PZC76678.1    + More
ODYU01001979    SOQ38921.1    RSAL01000004    RVE54625.1    NWSH01003295    PCG66596.1    GDQN01007004    JAT84050.1    PYGN01003650    PSN29455.1    NEVH01011917    PNF31121.1    KK853314    KDR08609.1    PNF31119.1    QUSF01000089    RLV93740.1    AGTO01001800    AHAT01018414    AHAT01018415    AHAT01018416    AHAT01018417    QRBI01000231    RMB91953.1    MUZQ01000188    OWK55692.1    LMAW01003036    KQK74518.1    AADN05000201    AWGT02000038    OXB81343.1    LSYS01008642    OPJ68289.1    RJVU01011952    ROL53209.1    HAEH01006380    SBR79077.1    HAED01006822    HAEE01010908    SBQ92948.1    HADZ01014130    HAEA01002783    SBP78071.1    HAEJ01002370    SBS42827.1    HAEI01003223    SBR83712.1    HAEB01019932    HAEC01000039    SBQ66459.1    HAEF01017408    HAEG01015172    SBR58567.1    AYCK01017144    KQ042328    KKF15961.1    AKHW03004818    KYO28703.1    AFYH01011934    AFYH01011935    AFYH01011936    GBHZ01000012    JAC94887.1    AERX01021523    KB105943    ELK31936.1    FR904426    CDQ63041.1    JH818774    EKC26973.1    AAPE02046303    AAPE02046304    AAPE02046305    AAPE02046306    AAPE02046307    AAPE02046308    BC065973    AAH65973.1    GBUG01000020    JAC96612.1    CM004479    OCT70472.1    CP026245    AWO99323.1    GCES01063437    JAR22886.1    GBIB01000010    JAC95042.1    AK046175    BAC32620.1    KN122326    KFO31095.1    AGTP01052904    LZPO01075906    OBS68517.1    AAQR03130901    AAQR03130902    GJ062397    DAA22394.1    BC113325    FR904313    CDQ58854.1   

Proteomes

UP000053268    UP000053240    UP000283053    UP000218220    UP000245037    UP000235965    + More
UP000027135    UP000276834    UP000016665    UP000018468    UP000269221    UP000197619    UP000005226    UP000265020    UP000007303    UP000051836    UP000000539    UP000198419    UP000190648    UP000261540    UP000242638    UP000261500    UP000028760    UP000261480    UP000002852    UP000261440    UP000192220    UP000261560    UP000050525    UP000007635    UP000265120    UP000261340    UP000018467    UP000261360    UP000008672    UP000189705    UP000005207    UP000261400    UP000265040    UP000261660    UP000265140    UP000265100    UP000265160    UP000264800    UP000261420    UP000261640    UP000265180    UP000192224    UP000261460    UP000264840    UP000193380    UP000005408    UP000221080    UP000001074    UP000001038    UP000265200    UP000265000    UP000186698    UP000257200    UP000246464    UP000009136    UP000189706    UP000261520    UP000028990    UP000005215    UP000233160    UP000087266    UP000092124    UP000005225    UP000265080   

PRIDE

Q2HJ40   

Pfam

PF00026   Asp        + More
PF14541   TAXi_C
PF01359   Transposase_1

Interpro

IPR021109   Peptidase_aspartic_dom_sf        + More
IPR009120   BACE1       
IPR033121   PEPTIDASE_A1       
IPR001461   Aspartic_peptidase_A1       
IPR001969   Aspartic_peptidase_AS       
IPR032799   TAXi_C       
IPR009121   BACE2       
IPR001888   Transposase_1       
IPR009119   BACE       
IPR033874   Memapsin-like       

SUPFAM

SSF50630   SSF50630       

Gene 3D

2.40.70.10    

CDD

cd05473  beta_secretase_like

ProteinModelPortal

A0A0N0P9Z3   A0A194QP43   A0A2W1BNY8   A0A2H1VDQ6   A0A3S2NRM5   A0A2A4J4D8   + More
A0A1E1WAL9   A0A2P8XBR8   A0A2J7QRA6   A0A067QVR7   A0A2J7QRA2   A0A3L8S139   U3JTE5   W5MGP0   A0A3M0IYY5   A0A218UQP8   H2T442   A0A3Q2D4W4   H3DA27   A0A0Q3T1R0   F1N916   A0A226PMM9   A0A1V4J835   A0A3B3S824   A0A3N0Z3Y5   A0A1A8PDI3   A0A1A8I891   A0A1A8CH12   A0A1A8U632   A0A3P9NNE7   A0A1A8PRS4   A0A1A8G7W0   A0A3B3VJ97   A0A1A8MPD5   A0A3P9NNH4   A0A087XNU3   A0A3B3X3P6   A0A3B5QZG1   A0A0F8AXU5   A0A3B4BPE8   A0A2I4CNB6   A0A3B3BIR4   A0A151MVW4   G3NRK5   A0A3P8WBP3   A0A3Q0RU93   A0A3B1IHI0   A0A3B4X2Z0   H3BFZ7   A0A3Q0S6U0   A0A098LWN5   A0A1U7S779   I3KIR1   A0A3B5ATN3   A0A3Q1JPI7   A0A3Q3F7V2   A0A3P8XV70   A0A3P8PH74   A0A3P9BCK9   A0A3Q3BRF1   A0A3B4UH38   L5M0R1   A0A3Q3S981   A0A3B4UEA6   A0A3P9K9I4   A0A1W4YWI6   A0A3B4F5A5   A0A3Q3CER0   A0A060W7N0   K1PZA2   A0A2D0T8P4   G1PAB0   A0A3B3H7C2   A0A3P9HRM4   Q6NZT7   A0A3Q2QT07   A0A0A1WDW4   A0A1L8FFW8   A0A3Q1F609   A0A2U9B5T5   A0A3Q1LZR2   A0A1U7RGL7   A0A146W007   A0A098LX26   A0A3B4A1C3   Q8BQY4   A0A091DLE0   A0A287DDZ1   A0A2K6G6V5   A0A1S3NQS5   A0A1A6GT58   H0WUA0   V6F9A9   Q2HJ40   A0A1S3SYP0   A0A2K6G6W1   A0A060W0U5   A0A3P8U9P1  

PDB

6BFX     E-value=5.60752e-46,     Score=464

KEGG

101735766    K04521 beta-site APP-cleaving enzyme 1 (memapsin 2) [EC:3.4.23.46] | (RefSeq) beta-secretase 1-like

GO

GO:0016021   GO:0004190   GO:0005764   GO:0005769   GO:0050435   GO:0009986   GO:0030424   GO:0005802   GO:0055037   GO:2000300   GO:0005887   GO:0043525   GO:0001540   GO:0005771   GO:0098686   GO:0006509   GO:0019899   GO:0098793   GO:0005768   GO:0006508   GO:0005794   GO:0030163   GO:0016020   GO:0022011   GO:0031643   GO:0004175   GO:0005783   GO:0005770   GO:0045121   GO:0030659   GO:0016791   GO:0016075   GO:0003677   GO:0005524   GO:0016787   GO:0004713   GO:0016491   GO:0015930  

PANTHER

PTHR13683   PTHR13683:SF245   PTHR13683:SF262  

Subcellular location

Cell membrane   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Golgi apparatus   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
trans-Golgi network   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Endoplasmic reticulum   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Endosome   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Cell surface   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Cytoplasmic vesicle membrane   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Membrane raft   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Lysosome   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Late endosome   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Early endosome   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.
Recycling endosome   Predominantly localized to the later Golgi/trans-Golgi network (TGN) and minimally detectable in the early Golgi compartments. A small portion is also found in the endoplasmic reticulum, endosomes and on the cell surface (By similarity). Colocalization with APP in early endosomes is due to addition of bisecting N-acetylglucosamine wich blocks targeting to late endosomes and lysosomes (By similarity). Retrogradly transported from endosomal compartments to the trans-Golgi network in a phosphorylation- and GGA1- dependent manner (By similarity).   With evidence from 2 publications.

SignalP

Position:   1 - 16,         Likelihood:  0.977551

 

 

Length:

388

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.01044

Exp number, first 60 AAs:

0.0063

Total prob of N-in:

0.00217

outside

1  -  388

 

 

Pi

254.515329

Theta

190.445741

Tajima's D

1.106975

CLR

0.246682

CSRT

0.683965801709915

Interpretation

Uncertain