SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13791
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 1.075 Nuclear   Reliability : 1.075 PlasmaMembrane   Reliability : 1.254
 

Sequence

CDS
ATGGACGTGGGCGGGAGATGTCGGCCACGTGACGAACCGAACGGGTACCGCCCAATCGTCGTGCTGGACGAGGCCGGTAAGCTCTTCGAGCGCGTCATCGCTAATCGCCTTGTCCAGCACCTGGAAAACGTTGGGCCTGATTTGGCTCCTAACCAATACGGTTTCCGGAGGGGTCGCTCGACCGTGGACGCGGTCTTGCGTGTCCGCCATCTCTCCGATTGTGCGTGCTCCGAGGGGGGCGTGTTGTTGGCTGTGTCGATTGACATCGCCAACGCCTTCAACACGATCCCCTGGAGCACGATCGTGGAATCACTTCGGTTTCACCGCGTCCCCAATAGTCTCCGCACCCTGATAGAGGACTACCTCTCAGGGCGGAGCGTGATTTTCCCCGAGAGAAGAGGATGGGGACGAAAAACGGTGTCGTGCGGGGTCCCACAGGGGTCGGTATTGGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTCCTCCGCGGTGCTGGCCTGCGTGGCGTCGACGTGGTGTGCTATGCCGACGACACGTTGGTGACGGCTCGCGGAGCTGACTACAGGACCGCAGCGATCCTTGCAACGGCGGCGGTCTCCACCGTCGTTAGCCGCATTCGGAGACTAGGTCTTGAGGTGGCCCTCCACAAGTCTGAGGCCGTATGCTTTCACCCGGTTCGGAGAGGACCCCCTCCGGGCGCGACGCTCATAGTCGGTGGAGTATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGCATCGTGCTGGACAGTCGATGGCGCTTCGACCACCATTTTGGTGAGTTGATTCCGAGGCTACTGGGCATGGCAGGTGCGTTAGTCCGTCTTCTGCCCAACGTTGGTGGTTGCAGCGTCGGTGTCCGACGCCTGTACCTGGGGGTCGTGCGCAGTATGGCCTTGTATGGCGCTCCCGTGTGGTCGCCCACACTCTCCGCACGCAATGCGGCGCTGTTGCTCCGAGCTCAGCGGGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACGATCTCCCGAGAGGTCGCCTGCGCCCTCGCTGGTTCCCTTCCTTGGGATCTCGAGGCCGAGGTATTGGCTACGGTATACCGGCGCAGGACACAGTCCCTGGGTCGGGGACGGACACCCGGCCTGTCGGCTGTCAGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCTAAATGGAGGGAGCGGTTGCTGGAGGAACTTCATCAAACCTCAGCCACCCGCCGGCGCACTCTCGAGGCCCTGGTGCCCGTGCTGGAGACATGGTCAGATCGGCGACACGGCGTGCTCTCCTTCCGCCTTACGCAGGTCCTCTCGGGGCATGGCTGCTTCGGGAGGTACCTGTGGAGGGTTTGCAGGAGAGAGCCACATCCGGGTTGTCACCAGTGCGGGCATCCGGATGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCACCCGCGGCGAGATCTCATCGCGGTGCTGGGGAGGGACCTCTCCTTGCGGGCTGTCATTGCCCGCATACTAGAGGACGAGAGTTCGTGGGAGGCCATGGCCAGATTTTGCGACCTGGTCATGGCGTTCCGCGAGGCTGAGGAGCGCGAAAGGGAGTGGAATCCCTCTTCGGCTCCTCAGCGAAGAAGGCGGGGTGGGCGACGCGGGCACGATGCTCCCGTTAATCTCCCGTAG
Protein
MDVGGRCRPRDEPNGYRPIVVLDEAGKLFERVIANRLVQHLENVGPDLAPNQYGFRRGRSTVDAVLRVRHLSDCACSEGGVLLAVSIDIANAFNTIPWSTIVESLRFHRVPNSLRTLIEDYLSGRSVIFPERRGWGRKTVSCGVPQGSVLGPLLWDIGFDWVLRGAGLRGVDVVCYADDTLVTARGADYRTAAILATAAVSTVVSRIRRLGLEVALHKSEAVCFHPVRRGPPPGATLIVGGVSIAVQPKLKYLGIVLDSRWRFDHHFGELIPRLLGMAGALVRLLPNVGGCSVGVRRLYLGVVRSMALYGAPVWSPTLSARNAALLLRAQRALAVRVIRGYRTISREVACALAGSLPWDLEAEVLATVYRRRTQSLGRGRTPGLSAVSRWRRAARHLAYAKWRERLLEELHQTSATRRRTLEALVPVLETWSDRRHGVLSFRLTQVLSGHGCFGRYLWRVCRREPHPGCHQCGHPDDDAQHALEACPRWEHPRRDLIAVLGRDLSLRAVIARILEDESSWEAMARFCDLVMAFREAEEREREWNPSSAPQRRRRGGRRGHDAPVNLP

Summary

EMBL
D85594    BAA19776.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    AB090825    BAC57926.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    RSAL01000481    RVE41577.1    KQ460685    KPJ12887.1    LBMM01024063    KMQ82623.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    LBMM01006671    KMQ90407.1    LBMM01019838    KMQ83439.1    LBMM01004272    KMQ92618.1    LBMM01002052    KMQ95336.1    LBMM01005733    KMQ91252.1    LBMM01006725    KMQ90373.1    LBMM01015018    KMQ84954.1    LBMM01006657    KMQ90417.1    LBMM01006063    KMQ90967.1    LBMM01007036    KMQ90099.1    LBMM01002480    KMQ94776.1    LBMM01008682    KMQ88705.1    LBMM01008448    KMQ88867.1    LBMM01003245    KMQ93755.1    LBMM01014122    KMQ85315.1    LBMM01004634    KMQ92224.1    LBMM01007425    KMQ89740.1    LBMM01015025    KMQ84953.1    GAKP01002292    JAC56660.1    LBMM01004505    KMQ92346.1    LBMM01003988    KMQ92922.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01005465    KMQ91492.1    LBMM01012412    KMQ86235.1    KMQ94772.1    LBMM01008422    KMQ88894.1    LBMM01008278    KMQ89009.1    GGMR01011682    MBY24301.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01005474    KMQ91485.1    LBMM01005948    KMQ91066.1    ABLF02011238    ABLF02014650    ABLF02009991    ABLF02009992    ABLF02054952    ABLF02041886    GFXV01003903    MBW15708.1    ABLF02034925    GGMR01004600    MBY17219.1    GGMR01006838    MBY19457.1    LBMM01003575    KMQ93366.1    GEHC01000964    JAV46681.1    LBMM01014956    KMQ84982.1    GGMR01000779    MBY13398.1    ABLF02041557    GALA01001776    JAA93076.1    GFXV01002090    MBW13895.1    GALA01001777    JAA93075.1    KU543679    AMS38363.1    GALA01000302    JAA94550.1    ABLF02020969    KU543683    AMS38371.1    ABLF02016340    GGFL01001583    MBW65761.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GALX01004785    JAB63681.1    GGMR01015159    MBY27778.1    LBMM01013668    KMQ85535.1    LBMM01005216    KMQ91703.1    GGMR01014195    MBY26814.1    ABLF02013358    ABLF02013361    ABLF02054869    GAPW01000192    JAC13406.1    ABLF02021100    GEHC01000915    JAV46730.1    GBXI01013438    JAD00854.1    APGK01005465    KB736249    ENN83233.1    ABLF02005203    ABLF02041316    GGFJ01001453    MBW50594.1    AB593321    BAK38639.1    LBMM01005845    KMQ91162.1    AAZX01012143    AAZX01012194    GDHC01002080    JAQ16549.1    GGFJ01001727    MBW50868.1    GGFJ01001369    MBW50510.1    ABLF02009073    ABLF02030702    ABLF02042963    GGFJ01001370    MBW50511.1    ABLF02004854    ABLF02041317    GGFJ01001454    MBW50595.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.0021764,     Score=99

Ontologies

Topology

Length:
567
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.45689
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01945
outside
1  -  567
 
 

Population Genetic Test Statistics

Pi
16.537966
Theta
18.711265
Tajima's D
-1.548089
CLR
331.760313
CSRT
0.0510974451277436
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号