SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13790
Pre Gene Modal
BGIBMGA011541
Annotation
endonuclease-reverse_transcriptase_[Blattella_germanica]
Location in the cell
Nuclear   Reliability : 3.745
 

Sequence

CDS
ATGGATAGTGGTCACGTGCTGTTTTACAGTGGAAATTCTCAGGGCAAGCACCAATATGGAACAGGATTCATGGTTGACGAGAGATATATTGCGAGCGTGATAAGATTTGAAGCTATTTCTGAAAGGCTGAGTATCCTACGGCTGAAGGGTAAATTTGCGAACTTCACACTTATTAACGCCTATGCCCCAACAGAACTGGCCAAAGAGGAAAACAAAGACAGCTTTTATGAAGATCTTGAAGCGGTGATCGATCAAGTACCAGAGTATGATGTCAAGATTATTTTAGGAGACTTTAACGCACAGGTCGGGAAGGAAGACATTTTTGTACCAACTATTGGAAAATATAGCAAGCACGACCAATCAAATGATAATGGTGTAAGGATGATAAGCTTTGCATCTTCCAAATCCTTGGTTGTGAAAAGCACTATGTTTCCGCATAAAGTCATTTATAAAGATACCTGGAAATCCGCTGACGGCGTCACTACTAACCAAATAGATCATGTCCTCGTTGACAATAGGCATAAAAACTGCATAATAGACGTGAGGAGTTTCAGAGGAGCTGACTGTGACAGTGACCACTATATGCTAGGAATCAAAATTAGAGCAAGAATTCAAACATGTAGAAAAGAATCCAGAACACAAAACGAAACAATAGAGCTAAAAAACCTTAAAGATAAAGAAAAGTGTAAATCTTTTCAGATTGAACTACTCAATAGATTTGATACTTTGGAAGTTTCGGATAGTATTGATGAAGAATGGAAACTTATTAGCAACACAGTTAGGGATATTGCATTGAAAACTTTAGGGAAGCGAAAAAAGCGTAATAATAGGAAATGGTGGACAGATGAATGCACCAAGATGATAGAAGAAAGAAGAAAACTAAAAATACAGGCAGAGCAAGATAGTAAGTGGAAGGATGAGTATATGGAAGCTCAAAGAAAAACCAGACAAGTTATAAGAACAGTCAAGCGAGAACACATGAATGACATCATGCAGAATATGGAAAACCTGATAAGAACGAATGAGGCTCGAAAATTCTACCAGGAAATAAGATCGTGTAATGTGGCGTCAGTACTTTCAAAACCTTCTGAATGCCCTCCACCGACGGAAGATTTAGATGACAACCCCCAAGATCCTGCGGAGGAAGAAGAAGTGGAGCCACTGAACTTCGAAGAAATAAAAAACGCTATTATGAGGCTTAAGAACAACAAAGCGCCAGGTATTGACAACCTACCATCTGAACTGTGGAAATACGGCGGAGAAGCCTTGCAGTCCAGATTGTACAATCTTATTAAAATGATATGGGAATCTGAACAACAACCTGTCCAGTGGTATTCGGGGGTCATCTGCCCCATACACAAAAAAGGCAGCCGGAAGAAATGCAGTAACTACAGAGGAATTGCTTTACTACCTACAGCGTACAAAATACTGTCATACGTTTTACTAAGCAGGTTAGAGCCGTATTCAGAAAAAATCATTGCGGATTATCAGTGCGGCTTCAGACGTAATCGTAGTACAGTCGACCAAATCTTTACTCTGAAACAGTTAATGGAGAAAAGATGGGAGTATGCACAAAGTATTCATTCGCTCTTTGTTGATTTTGCTAAGGCCTACGACAGCATAGATAGACCGACTCTATATAGAATCCTCACGCGCTTTAAAATCCCACAGAAACTTGTGAGAATGGTGGAGGTTGCTACTAGGGAAAGTAGAATGACGGTACGAGTTGGCGCTTCTTTCACTGATGAGTTTGACGTTGTGACTGGACTCAGGCAGGGGGACGCTCTGTCACCAATGCTGTTCAACCTGGCACTTGAACACGCCATACGGAAAGTGAACACACTTAGTGGCGGAGTGTGGCTCAACGGACAGCATAGGGTGATAGGATATGCCGATGACCTCGCTCTACTTGGAGAAAGAAAGCAGCACGTTATAGACGCACTCAACTGCCTTCAACAAGAAGCCTCTCGGATTGGCCTTCGCGTGAGCCACGAGAAGACAGAATATCTTCACATGCGTCGATATAAAAACATAAGACGGAAGCGAGAAGACCTAGTGGTGGGAAATACGAGGTTCAAAGGAGTGGCTAAATTCCGGTACCTTGGCTGCACTGTAACAGACACCAATGACAGGGAAGATGAAATCGAAATTCGTATACAAAATACCCTACGATGCAGTGCAGCCCTACACCCGGTTCTCTCTTCGAAGCTACTAAGCAGGCGCACCAAGATTCGGATATACAAGACTCTAGTCAGACCGATCCTATTGTATGGATGCGAAGCATGGACGCTCACACAGAAAGAAGAGGCAAAACTTCTCGTGACGGAGCGAAAGGTATTGAGAAAAATACTAGGACCAGTTCGGAAAGAAGACGGTTCTTGGCACGTCCGGAAAAATAAGGATGTGGAGAGGCTTTTTGGTGAGCCAAATATTCTGGGGGAGATGAAGGCACGGAGGCTCGGATGGCTCGGACATGTAGTACGTATGGAGCAGGATCGGGCTGTGAAACGGGTGTACACGGGTGTACCGGAGGGACGCCGCCCCGTAGGGAGGCCCAAGTACCGCTGGTGTGACGCTGTGGAAGGAAATTTACGGGAGCTCCAAGTGTCGGACTGGCAAGGTGTTGCGCAGCGCCGGGATGAATGGCAAAGCTTATTGTCGGAGGCCAAGACCCACTTCGGGGTCATAGCGCCAGCTCAGTAG
Protein
MDSGHVLFYSGNSQGKHQYGTGFMVDERYIASVIRFEAISERLSILRLKGKFANFTLINAYAPTELAKEENKDSFYEDLEAVIDQVPEYDVKIILGDFNAQVGKEDIFVPTIGKYSKHDQSNDNGVRMISFASSKSLVVKSTMFPHKVIYKDTWKSADGVTTNQIDHVLVDNRHKNCIIDVRSFRGADCDSDHYMLGIKIRARIQTCRKESRTQNETIELKNLKDKEKCKSFQIELLNRFDTLEVSDSIDEEWKLISNTVRDIALKTLGKRKKRNNRKWWTDECTKMIEERRKLKIQAEQDSKWKDEYMEAQRKTRQVIRTVKREHMNDIMQNMENLIRTNEARKFYQEIRSCNVASVLSKPSECPPPTEDLDDNPQDPAEEEEVEPLNFEEIKNAIMRLKNNKAPGIDNLPSELWKYGGEALQSRLYNLIKMIWESEQQPVQWYSGVICPIHKKGSRKKCSNYRGIALLPTAYKILSYVLLSRLEPYSEKIIADYQCGFRRNRSTVDQIFTLKQLMEKRWEYAQSIHSLFVDFAKAYDSIDRPTLYRILTRFKIPQKLVRMVEVATRESRMTVRVGASFTDEFDVVTGLRQGDALSPMLFNLALEHAIRKVNTLSGGVWLNGQHRVIGYADDLALLGERKQHVIDALNCLQQEASRIGLRVSHEKTEYLHMRRYKNIRRKREDLVVGNTRFKGVAKFRYLGCTVTDTNDREDEIEIRIQNTLRCSAALHPVLSSKLLSRRTKIRIYKTLVRPILLYGCEAWTLTQKEEAKLLVTERKVLRKILGPVRKEDGSWHVRKNKDVERLFGEPNILGEMKARRLGWLGHVVRMEQDRAVKRVYTGVPEGRRPVGRPKYRWCDAVEGNLRELQVSDWQGVAQRRDEWQSLLSEAKTHFGVIAPAQ

Summary

EMBL
HE799691    CCH14900.1    PYGN01000020    PSN57453.1    PYGN01000203    PSN51319.1    + More
PYGN01000070    PSN55417.1    PYGN01000324    PSN48495.1    PYGN01000219    PSN50892.1    PYGN01001004    PSN38555.1    AJVK01001578    PYGN01000107    PSN54137.1    GBBI01004263    JAC14449.1    GBBI01004261    JAC14451.1    GDHC01021627    JAP97001.1    KU311054    ALX81665.1    FJ265555    ADI61823.1    PYGN01000502    PSN45243.1    GBBI01004198    JAC14514.1    GBBI01004199    JAC14513.1    LBMM01005351    KMQ91586.1    GGMR01020071    MBY32690.1    GGFK01005184    MBW38505.1    ABLF02039015    GGFK01001949    MBW35270.1    GGFK01003613    MBW36934.1    GGFK01001798    MBW35119.1    PYGN01003402    PSN29545.1    GECL01001585    JAP04539.1    GGFL01003845    MBW68023.1    GBGD01000331    JAC88558.1    PYGN01001465    PSN34679.1    GGFL01003846    MBW68024.1    GGMR01006433    MBY19052.1    PYGN01000047    PSN56294.1    PYGN01000372    PSN47498.1    GECL01002632    JAP03492.1    GBRD01011073    JAG54751.1    ABLF02019047    ABLF02019049    ABLF02018097    ABLF02043469    ABLF02056908    PYGN01001388    PSN35187.1    ABLF02066124    GBBI01004262    JAC14450.1    PYGN01000613    PSN43351.1    GALA01001775    JAA93077.1    PYGN01000119    PSN53667.1    GAPW01000107    JAC13491.1    CH902621    KPU81727.1    CH902627    KPU74872.1    CH902657    KPU75308.1    CH902628    KPU75346.1    PYGN01000287    PSN49259.1    PYGN01000629    PSN43121.1    GGMR01010991    MBY23610.1    ABLF02027703    ABLF02061609    CH902623    KPU72899.1    CH902618    KPU79125.1    CH902633    KPU74667.1    CH902666    KPU74610.1    CH902622    CH902619    KPU75266.1    KPU77326.1    CH902630    KPU77522.1    CH902626    KPU79149.1    PYGN01001382    PSN35227.1    GAPW01000120    JAC13478.1    ABLF02042851    ABLF02037865    UZAG01001147    VDO10529.1    ABLF02017638    ABLF02041349    CH902714    KPU81861.1    GGMR01008290    MBY20909.1    CH963259    KRF97428.1    PYGN01000451    PSN46127.1    ABLF02018925    PYGN01000212    PSN51056.1    ABLF02003651    ABLF02007294    ABLF02007295    ABLF02056183    PYGN01000672    PSN42460.1    GAPW01000151    JAC13447.1    ABLF02020512    ABLF02020516    ABLF02046511    PYGN01001494    PSN34463.1    GEZM01048836    JAV76363.1    ABLF02020712    ABLF02020717    ABLF02054820    GDAI01000742    JAI16861.1    ABLF02012660    GGFK01002192    MBW35513.1    GGFK01002196    MBW35517.1    RQTK01002506    RUS68506.1    PYGN01000254    PSN50032.1    QOIP01000009    RLU18885.1    KPU76535.1    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    PYGN01000129    PSN53384.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF13359   DDE_Tnp_4
PF17919   RT_RNaseH_2
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR027806   HARBI1_dom       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR027124   Swc5/CFDP2       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
900
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00587999999999999
Exp number, first 60 AAs:
0.00052
Total prob of N-in:
0.00024
outside
1  -  900
 
 

Population Genetic Test Statistics

Pi
437.346157
Theta
225.260605
Tajima's D
3.041561
CLR
165.114642
CSRT
0.981500924953752
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号