SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13766
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X1_[Bombyx_mori]
Full name
PiggyBac transposable element-derived protein 4      
Location in the cell
Cytoplasmic   Reliability : 1.016 Nuclear   Reliability : 1.7
 

Sequence

CDS
ATGTCCCGCTATCATTTATCTGTTGTGCGTAGCGAAGACGATTCTGACAAAGAGGAAGAAGAGGTTACCCCACCGTTCGTGGTGCCCCGGGTGGCAAGAATGTTTATGGATGAAGAAGATGTGGAAGTTGAAGAAACTTGCGATAACGTTACTTTGGAGTGGCTTCCTCAATCGCCTCAGCCATCCAATTGTGTCTCAACGGCTGCCTCACCGACGCCTATTTTGCCGTCTCCCATCGAGCCAAGCAACAAATTTCAATTTGAATGGAGAGCGATTTCAATGCCTCAAATTGAACCTCATTTGAGGCGAGAACCGTTCTCGCAAATTAGTGGCCCTACAGTTTCTTTCACGAAACCATATGAAGCTTTTATTTCCATATGGGATAATGAAATAATGGAAGTAATCGTTAGGGAAACTAACATTTATGCACTGCAGGTGACAACGGCTATGTTAGAGAATGGGAACCTCTATCCTCATAGCCGAATTACTCATTGGCGAGATACAAATGTAAACGAACTTTACGTGTATTTTGCCATGGTTTTGGCTATGGGAATGGTGATCAAAAACCGGATAGACGAGTACTGGAACAGCTCTAGAGACATCTTCAGTACTCCTGGCTTCAGCACGGAGATGTCATATGACAGATTCGTGCTCCTGTCAAAATGCCTGCATTTTAATAATAATAAAAATCTTAACTCTGCAATGTTGACAGGATCCCAGGCTAAACTTTTTAAAATTAAACCTATAATAGACCACCTTAATTGCAAGTTTTCAAAATTATATAATCTATCTCAAAATGTGGCTCTCGATGAGAGCCTGACCATGTGGAAGGGCTGGCTTGATATAAACCAGTTCATCCCTAACAAGGCAGCAACAGTTGGGATAAAAACATATGAAGTGTGTGAATCCCAGACCGGTTATTTGTGGCGTTTTGAAGTACATGCAGGCCAGGACACCTTGGCACTTCAAGAAGATGATCCAGTCTCAGGGGGAGTACCAGCTCTCGTGCTCAGACTTTTAAATGGTCTTGAGCATAAAGGGCACACAATATGGATGGACAATTACTACAACTCTCCATCACTGGCACGGGAACTGAAAGTCCGGGGATTTGACTGCGTGGGGACCCTCCGGACAAACCGAAAATTCGTACCATCTGAATTTCAAAAGATTACAAAAAACGACATGATTGTCGGTCAAGTGTTGGGCTGCACCTCGGGAGATGTGGATATTATGGTGTGGAGGGATAGAAACCGCGTGGCTTTAATTTCAACATACCATGGTCTCGTAACTACCAGGTGTGGCGATACATTTAAGCCGACTGTCGTGCAAGATTACAATGCTAATATGGGCGGAGTAGACCGTAAGGACCAGCTACTCGCGATGTACCCCATAGAAAGAAGAAAGACTACAGTGTGACCGTTCTAA
Protein
MSRYHLSVVRSEDDSDKEEEEVTPPFVVPRVARMFMDEEDVEVEETCDNVTLEWLPQSPQPSNCVSTAASPTPILPSPIEPSNKFQFEWRAISMPQIEPHLRREPFSQISGPTVSFTKPYEAFISIWDNEIMEVIVRETNIYALQVTTAMLENGNLYPHSRITHWRDTNVNELYVYFAMVLAMGMVIKNRIDEYWNSSRDIFSTPGFSTEMSYDRFVLLSKCLHFNNNKNLNSAMLTGSQAKLFKIKPIIDHLNCKFSKLYNLSQNVALDESLTMWKGWLDINQFIPNKAATVGIKTYEVCESQTGYLWRFEVHAGQDTLALQEDDPVSGGVPALVLRLLNGLEHKGHTIWMDNYYNSPSLARELKVRGFDCVGTLRTNRKFVPSEFQKITKNDMIVGQVLGCTSGDVDIMVWRDRNRVALISTYHGLVTTRCGDTFKPTVVQDYNANMGGVDRKDQLLAMYPIERRKTTVXPF

Summary

Keywords
Complete proteome   Reference proteome  
Feature
chain  PiggyBac transposable element-derived protein 4
EMBL
KQ459989    KPJ18766.1    RSAL01000155    RVE45659.1    RSAL01001012    RVE40990.1    + More
RSAL01000045    RVE50637.1    ODYU01000749    SOQ36006.1    KZ150113    PZC73302.1    RSAL01000024    RVE52239.1    NWSH01005160    PCG64390.1    NWSH01000726    PCG74565.1    NWSH01008683    PCG62453.1    NWSH01005605    PCG64100.1    RSAL01000003    RVE54733.1    NEVH01026090    PNF14815.1    JTDY01002247    KOB71806.1    KZ150197    PZC72319.1    NWSH01000091    PCG79681.1    NEVH01017475    NEVH01002684    NEVH01001351    PNF24176.1    PNF41738.1    PNF42927.1    NEVH01026393    PNF14286.1    NEVH01021985    PNF18924.1    NEVH01009069    PNF34004.1    NEVH01026401    NEVH01025126    NEVH01020854    NEVH01013255    NEVH01000629    PNF14193.1    PNF16176.1    PNF21085.1    PNF29260.1    PNF43158.1    NEVH01011876    PNF31583.1    RSAL01000056    RVE49901.1    RSAL01000097    RVE47692.1    NEVH01026109    PNF14626.1    PZC73303.1    RSAL01000075    RVE48877.1    NEVH01016950    PNF24933.1    JU326601    AFE70357.1    CM001259    EHH27175.1    CM001282    EHH62949.1    CABD030095328    AQIA01062119    JSUE03037923    ABGA01233763    NDHI03003689    PNJ08370.1    AK057200    AK094816    AK289491    AC079203    AHZZ02030739    AQIB01116437    AACZ04060380    GABC01006592    GABD01003812    GABE01001690    NBAG03000487    JAA04746.1    JAA29288.1    JAA43049.1    PNI20010.1    GEGO01007089    JAR88315.1    GEDC01003168    JAS34130.1    GEBQ01017560    JAT22417.1    BABH01021160    BABH01021161    BABH01021162    BABH01021163    BABH01041064    NEVH01006795    PNF36382.1    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    NEVH01018384    PNF23441.1    CCAG010009903    NEVH01024959    PNF16251.1    KK120039    KFM77390.1    NEVH01015302    PNF27192.1    KK115494    KFM65244.1    NEVH01025150    PNF15655.1    NEVH01009368    PNF33480.1    NEVH01006740    PNF36596.1    NEVH01005303    PNF38748.1    KK116918    KFM69084.1    ABLF02006169    ABLF02055685    GEBQ01012026    JAT27951.1    GEGO01006047    JAR89357.1    GEBQ01027849    JAT12128.1    GECU01003439    JAT04268.1    GEDC01002971    JAS34327.1    NEVH01008275    PNF34265.1    AB300556    BAF82019.1    AB300558    BAF82021.1    HAEI01002033    SBR78690.1    HAEA01000274    SBQ28754.1    NEVH01017495    PNF24164.1    HAEH01008939    SBR85849.1    KK116466    KFM67844.1    HADZ01012453    SBP76394.1    ABLF02028028    KK118194    KFM72419.1    LSMT01000021    PFX32631.1    GECZ01016293    JAS53476.1    BABH01028864    GACK01007981    JAA57053.1    GEDC01004717    JAS32581.1    NEVH01017534    PNF24104.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
PF01094   ANF_receptor
PF05225   HTH_psq
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       
IPR018159   Spectrin/alpha-actinin       
IPR028082   Peripla_BP_I       
IPR001828   ANF_lig-bd_rcpt       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
SUPFAM
SSF53822   SSF53822        + More
SSF46689   SSF46689       
SSF57667   SSF57667       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
474
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.92682
Exp number, first 60 AAs:
0
Total prob of N-in:
0.16464
outside
1  -  474
 
 

Population Genetic Test Statistics

Pi
199.880218
Theta
171.95684
Tajima's D
0.656932
CLR
0.059643
CSRT
0.559822008899555
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号